Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15080  (registered. 2002)
Contig Information
Length 1912 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 4
Wh_r Root 2
Wh_yd Spikelet at late flowering 5
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0352300 [Oryza sativa (japonica cultivar-group)] >gi|108708152|gb|ABF95947.1| Nucleolar protein Nop56, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548593|dbj|BAF12036.1| Os03g0352300 [Oryza sativa (japonica cultivar-group)] >gi|125586258|gb|EAZ26922.1| hypothetical protein OsJ_010405 [Oryza sativa (japonica cultivar-group)]
Score 1042
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15080
gctaacCTCTCCCCCGCCTCCGCC*CCCAAACCCCTCAGCCGCCGCCGGCGAAGCGCGCGGCGAG*ATGGCGCTCTACCTGCTCTTCGAGTCCGCCTCCG
GGTACGCGCTCTTCCACGCGCACGGCATCGACGAG*ATTGGGCAGAGCGTCGACGCCGTCCGCTCCACCGTGCTGGACCTCAAGCGGTTCAGCAAGGCCG
TCAAGCTCGCCGGGTTCACCCCCTTCCTCTCCGCCGTCGACGCCCTCAACCAGTGCAACGCCATCTCCGAAGGGATCATGACTGACGAGCTTAGGAACTT
CCTGGAGCTCAACCTGCCCAAGGTGAAGGAGGGGAAGAAGGCCAAGTTCACCGTCGGCGTCATGGAGCCCAAGGTCGGGTCCCACATCACCGAGGCCACC
GGAATCCCTTGCCAGTCCAACGACTATGTCCAGGAACTGCTTCGTGCAGTGCGGCTGCATTTCGATCAATTCATTGAGCAACTCAAGCCATCTGACCTGG
AGAAGGCCCAGCTAGGTCTGGGACATAGCTATAGCAGGGCCAAGGTGAAGTTCAATGTGAATCGTGTGGATAATATGGTGATTCAAGCTATCTTTCTGTT
GGATACACTTGATAAGGATGTCAATTCCTTCTCTATGAGAGTGAGGGAGTGGTATGGATGGCATTTTCCTGAGCTGGTCAAGATTGTGAATGACAATTAC
CTCTATGCTAAGCTTGCCAagtttgtggtaaacaaatctgactTGTCGGAGAAGGACatttccaGCTTTAGCGGATCTAATTGGAGATGAAGACAAGGCA
AAAGAAATTGTTGAGGCAGCAAAGGCATCTATGGGCCAGGATCTTTCACCTGTTGATTTGATCAATGTCCAACAGTTTGCTCAGAGGGTCATGAATCTAT
CTGAGTACCGTAAAAATCTCTATGAGTATCTGGTGACAAAGATGAATGATATTGCACCAAACCTGACGTCATTGATTGGTGAAATGGTTGGAGCCCGGCT
AATCTCTCATGCTGGCAGTCTTTCAAATCTTGCAAAATGCCCTGCATCTACTCTGCAGATACTGGGTGCTGAAAAGGCGCTCTTTAGAGCTCTCAAAACA
CGTGGAAACACACCAAAGTATGGCCTCATATTCCACTCATCTTTTATTGGTCGTGCATCAACCAAGAACAAGGGAAGGATGGCCCGATACCTTGCAAACA
AATGTTCCATTGCTTCACGTATTGACTGCTATTCAGATATGAGTAGCTCCATTTTCGGCGAGAAGCTGCGTGAACAAGTTGAGGAGAGGCTAGACTTCTA
TGATAAGGGTGTTGCACCCCGCAAGAACCTTGATGTGATGAAAGCTGCTATTGATGGCTTGACAAACACAGAGGATAATGACGGCAAAGAGAATGGTGAC
GCATCTGTGAAGAAAAGCAAGAAGAAGAAGTCCAAAGCTGAGGCTAACGGTGACGCGATGGACGTTGAGAATGCCACGGCAGAAGCTGAAACTGGAACCG
AGAAGAAAAAGAAAAAGAAGCACAAGCTTGAGGAGCCGAAGGACGAGGAGATGCAAGCCAATGGCGATGATGAGACCCCTAAGAAGAAGAAAAAGAAGAA
CCGTGAAGCCGAGTCTGTTGATCCTAAGACAGGCACAGAGGGGAAATCCAAGAAAAAGAAGAAGAAATCCAAGACTGACGACGACGAGTAGTAGATTAGT
ACCTTAGTACCTAGCAGCGAATGTTGAAGCCGATTGAGGATGAAATTTTTTGTACCGACTGTTTAAGTGTGTACTCTTTGAGCCTCTTTGAGCCCTTGAT
GAGGTCTGTAATGTAGCGTGGCATGGACTGAAGCGGCGAATCTGTATTACATTTGATGTTGCAGtatggcGTTTATtgggaatggcttaagctttcctag
ttaaaaaaaaaa
page-top