Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5220  (registered. 2012)
Contig Information
Length 1092 bp
Clones alternative view 54 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 3
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XA Root 1
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464585|ref|NP_001055892.1|| Os05g0489600 [Oryza sativa (japonica cultivar-group)]
Score 366
Evalue 3.00E-99
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5220
GGCACGAGGCGACAGCCATCTCTTCCGTGCGGTTCCAAGCTCCAACTCCCACGCCCGTCTCCCCCGAGATCAGGAGGAGCACGCCGCACCGGAGCGCCGA
GACCTCGAAGCCTTCGTCTCCACCTCGGAGCAGAGATGGGGCTCACGTTCACCAAGCTGTTCAGCCGCCTCTTTGCCAAGAAGGAGATGAGGATTCTCAT
GGTTGGTCTTGATGCCGCTGGTAAGACCACCATCCTCTACAAGCTCAAGCTCGGAGAGATCGTCACCACCATCCCAACCATCGGATTTAACGTCGAAACT
GTTGAATACAAGAACATCAGCTTCACTGTTTGGGATGTGGGGGGCCAAGACAAGATCAGGCCCCTGTGGAGGCACTACTTCCAGAATACGCAGGGCCTCA
TTTTTGTTGTCGACAGCAATGATAGGGAACGTGTTGTTGAGGCTAGGGATGAGCTCCACAGGATGCTGAATGAGGATGAGCTGCGTGATGCTGTGTTGCT
TGTATTTGCAAACAAACAAGATCTTCCTAATGCCATGAATGCTGCTGAAATCACCGACAAGCTTGGTCTGCACTCCCTGCGCCAGCGGCACTGGTACATT
CAGAGCACTTGTGCAACGTCTGGCGAAGGGTTGTACGAGGGACTTGACTGGCTCTCCAACAACATTGCCAACAAGGCTTGAAGCGTCTCGACAAGTGCTT
CATCAAGAAACAAACGTGCTGGATGTCTCAACAACTCACTGCTACCATTTTACATATTGTGATATATATACACTGCACAAGAGATAGTATGTGTGCGTAT
GTGACAGGCAGAAGCTCCCTTCTTTAAGTGAGCTAGTATCAGGTCAGGTTGTCTTTTTTTGTATGGATATTATCAGCTGCTGTTCGGTGGTTTTACAAGG
TTTAATGTGTCGACAATGTGTGTCTGAACCCCTATCTTTTTGAGTTTTAGTAAGATTGGATTATGGTTGCCAATGTTGGTTGGTTCAGTTGAGTGATGTG
GATGGTACATGTTGCGAACATACTTATGTGAGCGATGTTTTCAGTAGTTCTGTATAAAAACCAGTCGGTGCTGGTTCTGCTCAAAAAAAAAA
page-top