Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig522  (registered. 2012)
Contig Information
Length 874 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig522
TTAAATACTGCAATGTACATCTCAAGCGGTTAGTAGTACATAATACAACATGCCCCCTCTTGGTACGGGTCAGCCCCTTGCATTCTCACAATGTCATCAC
AGGGCTTAGTAGTGAAATAACTTAACGGCCATTCAAATTTACTAACCAAACATAACAATATGCAAAAGACTTCAACATCTAAAGCCAGGAGCACAAACGT
ATTTTGAACTAGTATATTGTCCATATGGCAGCTTGAATTGCACCTGCATCTCAACCCTCCAAGTGCCGCCCAGACAGAATCAGGTTTTGTGGAGTTGGTT
GCAGTAATTCCGCCATCTACCAAGACATTTCTATTCAAACACATCTTAGAGATCTTGGCTGTTCACATTTTCAGATTCATCATCTTGTCCGTCATCACGA
GTGTCAACTTCAGTGTCTTCTTGAACTCATATGCCTCGGCAATGAGTATTCTGTTCACACGTGCAATGGCCACATAAGGGGCTTTGTCCGAATCGCTAAA
GGATTTCCAGTTTTCAGCAGCTTTCCTTTTAATAGCATCTACGGACGGCTTGTCATAGACGCCTTTGAAGTTGTCCATCCAGAAGTAGTTCTGGTAGGTG
AACAGGGCGTGCTGGGCGAGCTGTTCATCCAACGGCTTCTCTGTTGCAATGCTCATTACCGCCAACCCGCGTGTAACATCGGAAAGGTCATGGGTCTTGG
GCTTCTCCGCAACATTGCTCTTCACCGCCAACTTGCCCTTGGCCTTCTTCCCCTTCCTGCACNTGGTCGAGGGCTTCCGCTCCTCCGCTCCATCGCTCTT
CGCTGCCGACTTGCTGTCGGCCTCGTACGTGGCGGCGGCGCCCGTGGATGCGGTCTGCTTGCAAGCAGTCATGT
page-top