Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15058  (registered. 2002)
Contig Information
Length 608 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_r Root 6
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit immunophilin [Zea mays] >gi|54111525|gb|AAV28625.1| immunophilin [Zea mays] >gi|195605690|gb|ACG24675.1| peptidyl-prolyl isomerase FKBP12 [Zea mays] >gi|195605704|gb|ACG24682.1| peptidyl-prolyl isomerase FKBP12 [Zea mays] >gi|195619378|gb|ACG31519.1| peptidyl-prolyl isomerase FKBP12 [Zea mays] >gi|195620748|gb|ACG32204.1| peptidyl-prolyl isomerase FKBP12 [Zea mays] >gi|195658115|gb|ACG48525.1| peptidyl-prolyl isomerase FKBP12 [Zea mays]
Score 551
Evalue 7.09773e-55
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15058
ttcggcacgaggcACCACGCCAACGCTGCGCCGCCGCCGAACTTTGGAGAGGAGACGCGGAGGACGGCAAG*ATGGGATTCGAGAAGGAGATCCTGAAAG
CCGGCACCGGCCCCAAGCCCGTCAAGGGCCAGAAGGTCACCGTCCACTGCACCGGCTACGGGAAGGACGGTGATCTGTCTAAGAAGTTTTGGAGTACCAA
GGACCCTGGGCAGCAGCCATTCTCTTTCAACATTGGTCTCGGTTCAGTAATCAAAGGATGGGATGAGGGAGTCATGGGCATGCAATTGGGTGAAGTCGCC
CGTCTTACGTGCACCCCAGACTACGCTTATGGATCCGGTGGCTTTCCAGCCTGGGGAATTCAACCAAACTCCGTGCTGATATTCGAGATCGAAGTTCTTA
GCGCCAAGTGATGCGCAATGCGATTCATGATGGATCTATAGAACACTGCAGCATCGCCATGCCTCTCGATTACCAAAATAATTGTAACGCCACTTCATGT
TAAGTGCCACATTATGGTGATGTTCCAAGTGCATTGAGTGAAACTTTGGAACCCTATTATCCTTTcggattctggtactagtttctgggtgcccttgttg
cnaaaaaa
page-top