Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15044  (registered. 2002)
Contig Information
Length 1252 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 7
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_23887 [Oryza sativa Indica Group]
Score 1404
Evalue 3.1529e-153
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15044
gatgatgaccatcattgatcttgcgcgcaatattcgggaacggcacagcaaagctctcaaaacgccaCTGAAGGAGATGGTGGTTGTTCACCCTGACAGT
GAATTTCTTGAAGACATCACTGGAAAACTGAAAGAGTATGTCATGGAGGAGATGAATGTTAAGACTGTGACTCCATGTAATGATCCCATGAAGtatgcTT
CTCTGCGGGCAGAACCCAATTTTagtgtgctaggtaaaagACTAGGAAAGGACATGGgcaaagtatcaaatGAAGTGAAGAAAATGacccaggagcaaat
CTTAGCCTTTGAGcaaagcGGAGAGatttcgtTCCTTGgtcatTGCctgacGCTAgacgaTATTAAGGTGGTCCGACAGTTCAAGCGTCCTGTGGATGTA
TCAGAGAAGGAAATTGATGCCGCGGGAGATGGTGATGTGTTGGTCATTTTGGATCTCAGAGCCGATCAATCATTGATTGAAGCTGGAGTGGCTCGAGAGG
TTGTAAACAGAATCCAGAAATTAcggaAGACTGCTCAGCTTGAACCTACAGACTTAATTGATGTGTACTACGAGTCTGTAGACAACAGCAATACACTTGA
AGAAATTTTGCAGTCACAGGATCAGTATATTAGGGACGTGCTTGGTAATTCGCTAGTTCCAAAGGCAGCGGCAACATCAGATATGGTCGTTATCTGCGAG
GAGTCTCATACTGTACATGACATGTCATTTGTCATCTACATTGCAAGATGCATGCCTGTGCTCGCAGCTGATCTCCTTTCCTATGCCTCAGGCAACAGTG
ACCACGTTGAGGCGTTAAGAGTGTATTTGCTGTCAAG*GTCCATTTCCAGATTGAAGAACGAATTCCAGACTGGAAATGGCAAGATTACGGTCAGGTGCA
TCGAAGGCTATCCCCCAATTGATCTGCAGCTAGGGAAGCATGTTTTCCTTAGCGCTGGCGATTTTTACCAGGCTAACCGCTCTTGATTCTTGTCTCCGAG
CATCCCAGTTTTGAGTAGTTTTGTCATTTTCAACCGCAATTCATTCTAATCAGGCTGATTCTGTTTGTGCCTCACAAAAGCAATGTATTTACTTAAATGT
GCTGCCAAGGATCGAAGGGAAAGGGAATTGTCAATTGTGTATTCAGAGACTCATGTGTATGAAGTATTA*CAGTGTG*C*TCGTGTTAGTGTACACATTG
CAAATAGCAGCTTGCCACAAGTATTGCGCTTTGTTTGTACTTAAaaaaaaaa
page-top