Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15031  (registered. 2002)
Contig Information
Length 1249 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Probable nicotianamine synthase 2; AltName: Full=S-adenosyl-L-methionine:S-adenosyl-L-methionine:S-adenosyl-methionine 3-amino-3-carboxypropyltransferase 2; AltName: Full=HvNAS2 >gi|4220596|dbj|BAA74582.1| nicochianamine synthase 2 [Hordeum vulgare subsp. vulgare]
Score 1571
Evalue 1.3613e-172
Total Hit Count 98
Registered year 2002
Contig Sequence     [ Download ]
>Contig15031
cacttgcacatacaaggtgtatacaag*acattcgcgtgtaaacaccacacatagTTTATTGGGTAGAAACATCACATGGCTTAATTCAAATGCATCAGT
AGTAGTAGGAGAATTACCACGAGCGTGCGATTGCAAGCGATCAAGCAGCGAGGTAGGAAAATTACCACATGCACGTTCATTATTGTCCGCTGGCGAGGAT
CGGTCAAAAGGCCACTTCGGCGTTGGCAAACTCCTCTCTCTTCTGTGTCATATCCGCCACCATCTCACCGAACCTGCACGGCGGGCTGACCACCGGCACC
GTGGAGCGAGCAGACTGTCCACCCACAGCAGGCCCGCTGCGAAGTCCACTAACATGCACGTCCTTGGACTTCTGTGCGATGATGACGGAGTTCACCACGT
CGTCGTCTGGATGGCACACGGCCAACACCTTGAACCCACCTAGGGTGATGTCCTGGGGGTCGACGATCGGGTACAGGAACCCGCGTGCCCTGTGTGCGCT
GCGCACGACGAGGGCCGCCCCGTCTGCCATGTGTGTGCCGAGGTGTGCTATCACCTTGGCCTTGTCCTCAGCCGCCATGCCAACAAGTGCGGCCAGGAAG
ACCACGTCGTACTTGGCGAGCTCGCCAGCGAGGTCCGCTACGTCGGCCGTGTGGAACGACATGCGGGCGCCCATGTCCTTGTCGGCGCGGAACAGCTTGC
TGGCGCGGTCATTGGCCGCGCCGCACAGGTCGTAGTTGTCGAACATGGTGTCGGGCAGGTGGCGCGCGGCGAGGACGAAGGAGCTGAACGGCAGCGGGCC
GGAGCCGATGAAGGCGACGCGGGCAGGGGCGATGCCACCAGGCACGTAGCGGGCCAGGAGCTCGTACTCCAGCTTGCTGAGGTTGATGTAGTTGCTGTAG
TAGGGGAACATGCCGAGGTGGTCCAGAGGGTTGTCGAAGGCGGCGAGCATGTCGGAGTAGTGCGCCTCCAGCTTCCCCTCGGCCTCGGAGCAGAGGCGGA
TGAGGCCCTCCCGCATCTCCTGCGCCTCCGGGCCGAGCTTGGTCACGTCCACGGGGCTCGGGGGAACGCACGCCGTGACCAGCTCGGTGAAGAGCAGGTC
GACGGCCGGGGAAGGGCTGAGCGACGGCAGCTTGGCGATGGCGGCGTGGAGCCCGGTGATCTTCTCCACCAGGGCATCCACCTCCTTGTTgttctgggca
gccatttcactggtgttgttggtacctcagtgcaggcagacgagtggag
page-top