Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15016  (registered. 2002)
Contig Information
Length 1269 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 2
Wh_oh Pistil at heading date 1
Wh_yf Spikelet at early flowering 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0456300 [Oryza sativa (japonica cultivar-group)] >gi|113579282|dbj|BAF17645.1| Os05g0456300 [Oryza sativa (japonica cultivar-group)] >gi|215741092|dbj|BAG97587.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1363
Evalue 1.82264e-148
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15016
gctctCGTCTCCGCGCGCATCTtccacTCGGTTCCCACTTGCAAGTGCGAACACACTCTGCGCACGCTAGCTACGTACGAGCGCTGAAGGCATGGCCAGC
CACTTCGTCCTCAGCACCGGCGCCAAGATCCCGTCGGTCGGGCTCGGCACCTGGCAGTCCGAGCCCGGCGTTGTCGGCGACGCCGTCTACGCCGCCGTCA
AGGCTGGTTACCGGCACATCGACTGTGCTCAGGTCTACGGCAACGAGAAAGAGATCGGATTCGCCCTCAAGAAGGTGTTCGACGAGGGCATAACCAGCCG
GCAAGATCTCTTCATCACCTCCAAGCTATGGTGCACTAACCACGCGCCGGAGGACGTGCCGGTGGCGCTGGATGGCACGCTCCAGGACCTGCAGACCGGC
TACGTGGATCTTTACCTCGTGCACTGGCCGATCCGGATGAAGAAGGGCGCCGGCTTCAGCCCGG*AGAACGTCATCCCGGCCGACATACCGGCGACGTGG
GCGGCGATGGAGGGCCTCTACGACTCCGGCAAGGCCCGTGCCATCGGCGTCAGCAACTTCT*CGTGCAAGAAGCTGGAGGAGCTGCTCGCCGTCGCGCGC
GTGCCGCCGGCGGCCAACCAGGTGGAGTGCCACCCCGTCTGGCAGCAGGCCAAGCTCCGGGACCTCTGCGCGTCCAAAGGGATACACTT*CTCCGCCTAC
TCGCCGCTGGGATCGCCGGGGACGTTCAAATCATACAGCGTGCTGGAGCACCCGGTGGTGGTGTCGACGGCGGAGAAGCTGGGGAAGACGCCGG*CGCAG
GTGGCGCTGCGGTGGGGGATCCAGGCGGGGCACAGCGTGCTCCCCAAGAGCACCCACGAGGAGAGGATCAGGGCCAACTTCGACGTCTTCGACTGGTCCA
TTCCGAGCGACCTGTTCGCCGGCTTCTCTGAAATCGAACAAACGAGGCTGATCCGCGGGAAATTCTGGACGCACCCGGAAGGCGTGTTCAAGTCCGAAGA
AGAGATCTGGGATGGAGAAATCTAGTCTGAGCAGTTGCGGAGGGAGGGCAGGCAGCTTACTTTCGTATGTCGGAGGAGGCTGCCATGGCAACGGAATAAC
GTGGTAGTGATAATCAGCAGTCGAATGAGCTCGAGCTTGGCTGCTGTTGGCATGTATTTGCATGAGTGATTTGAGT*CCAGAATAGCTTTGTT*CTCCTC
TGTAATTTTTATGTTTTTATTCATCAGTCAATCCAAAGTcattgtaaaaaagaagcagatataacagtc
page-top