Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14980  (registered. 2002)
Contig Information
Length 1266 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13867 [Oryza sativa Indica Group]
Score 625
Evalue 6.86582e-63
Total Hit Count 225
Registered year 2002
Contig Sequence     [ Download ]
>Contig14980
ggtcatgctcctcaaccccgtctccacgCCGGGCAGCTTCCagg*agTTCTCCCCTATTGGGTTTGGAGGCGAGCAGCCGCAGTCGTTCTTCAGCGTATT
CAGCGACGaggttaTCCGGGCGGCATTTAACACTCGGCAGCGGGAGGATGTGGACAGAGTGTTCGAGACGAAGAGCAGAGGTGAGGGTCAGATATCTGAG
GGGTCGGAGGAGCAGATACGGGAGCTGAGCAGGTCGTGCTCCAGGGGAGGACGCGGCGGTGGCGGCGGGTCGGGTTCCGAGAAGGAGGACATCCAGCCGC
GCAGCCTCACCGGCGAGAAGCCCCGCTACTCGAACAAGCACGGCAGGTTCCACCAGATCACCGGCGACCAGTGCCACCACCTCCGCAAGCTCGACATGGA
TGTCACCCTCGTCAACATTACCCGGGGCTCGATGACGGCGCTGAGGTACACCACCCGGTCGACCAGGATCTACATCGTCGTGGAGGGGCGCGACGGCTAC
TTCGAG*ATGGCGTGCCCGCACGTCTCCAGCTCCGGCCGTTCTGAACGCCGGGAGCACGAGCAGGAGCGCGAGCGCGAACACGGACACGGCAGGAGAAGC
GAGGAGCGCGGGCAGGAGCACGGCAGGAGGAGCGAGGAGGAG*GAGCACGGCCAC*GGCGGCGAGCAGGAGAAATCGAGGGGCTACAGGCAGGTGAGGGC
CCAGATCAAGGTGGGGTCGGTGATCGTGCTCCCCGCGGGCCACCCGGCGACGTTCGTGGCCGGGAACGAGGGGAACCTCGCCCTGCTGTCCTTCGGCGTG
GGCGCCAACAACGACGAGGAGGTGTTCGTGACCGGCGGGAACAGCGTGCTGAAGCAGCTGGACGAGGCGGCCAAGGCGCTGGCGTTCCCCCAGCAGGCGA
GGGAGCTGGCGGACAGGGTCATCCGCGCGCAGCCGGAGTCCGTGTTCGTCCCCGGCCCGCAGCAGCAGCGCCGCGTCGCCGACATGTGAGCGACGATCTC
CAGCGCGCGCATGCGGTCCCTGGA*GCTGCATGCATGCATGAGTGTACATGTGAGTGTGACGGGAATAAATAGCTAGCACGGTACTGCGTACTACAGTAC
GTGCGTGTAGCAGAGGAGAGGAGAGGAGAGACGATGCTTGTGTTCGTGCGCGGTTATGCATGAATGCATGCATGCACGTGAGTTTTCTATGCATGTAGTA
GTACGTGAGTTTTCCGGTAATAAAAGACGTGACCTTGCCCGTCGGCTCGTTGgaacaaaaaaaaaa
page-top