Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14962  (registered. 2002)
Contig Information
Length 1128 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_e Seed DPA10 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha-gliadin [Crithopsis delileana]
Score 197
Evalue 2.4821e-13
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14962
gaggaattcggcacgaggaagacctttat*atccttgccctccttgctattGTGGCGACCACCGCCACAACTGCAGTTACAGTTCCAGTGCCACAATTGC
AGCCACAAAATCCATCTCAGCAACAACCACAAAAGCAAGTTCCATTGGTGCAACAACAACAATTTCTAGGGCAGCAACAACCATTTCCACCACAACAGCC
ATATCCGCAGCCGCAACCATTTCCATCACAACAACCATATCCACAGCCACAACCATTTCTGCCACAACTACCATATCCGCGTCCGCAACCATTTCTACCA
CAACAACCATATCCACAACCGGAACCACAGTATCCGCAACCACAACAACCAATTTCGCAACAGCAGCAGCAGCAACAACAACAACAACAACAAATCCTTC
AACAAATTTTGCAACAACAACTGATTCCATGCAGGGATGTCATCTTGCAACAACACAACATAggcGCATGCAAGCTCACAAG*TTTTGCAACAAAGTACT
TACCAGTTGTTGCAACAA*TTGTGTTGTCAGCAGCTGTGGCAGATCCCCGAGCAGTCGCGGTGCCAAGCCATCCAGAATGTTGTTCATGCTATTATTCTG
CATCAACAACAACAACGACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAAC
AACAGCAGCAACAACCGTCGAGCCAGGTCTCCTTCCAACAGCCTCAGCAACAATATCCATCAGGCCAGGG*CTCCTTCCAGCCATCTCAGCAAAACCCAC
AGGCCCAGAGCTCTGTCCAACATCAACAACTACCCCAATTTGAGGAAATAAGGAACCTAGCACTGCAGACGCTACCAGCAGTGTGCAATGTCTACATCCC
TCCATATTGCTCGACCACCATTGCGCCATTTGGCATCTTCGGTACTAACTGAGAAGAGAAGAACTCTAGTACTAGATATATGAAACACTGTTTTCTTAGT
*CC*ATGGTTTGGTCATTGTAGCGGTGAGAAAATAAAGTGACATGCACTAT*CATGTAAGAACCCGAACTATACTAGTTCAAActtgggaatAAAAGACA
AACACaggtnttgtctacaaaaaaaaaa
page-top