Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14950  (registered. 2002)
Contig Information
Length 669 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.3; AltName: Full=wcH2B-8 >gi|531058|dbj|BAA07157.1| protein H2B-8 [Triticum aestivum]
Score 441
Evalue 4.93438e-42
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14950
gcaaTTCCCCACCACCAGTCCCCTCGCACCCTCCGGCGAACCACCG*CACCTCTCCCCGGCGAAGCAACAGCGTCCGATGGCTCCCAAGGCGGAGAAGAA
GCCGGCTGCCGCTGAGAAGACCCCG*GCGGCGGAGAAGACCACGGCGGGGAAGAAGCCCAAGGCCGAGAAGCGGCCGCCCAAGTCCAAGGAGGGCGGCGC
CGACAAAAAGAAGAAGAAGGCCAAGAAGAGCGTGGAGACGTACAAGATCTACATCTTCAAGGTGCTGAAGCAGGTGCACCCGGACATCGGCATCTCCTCC
AAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTGGCCGGCGAGTCGGCCAAGCTCGCCCGCTACAACAAGAAGCCCACCATCA
CGTCCCGGGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGGGAGCTCGCCAAGCACGCCGTCTCCGAGGGCACCAAGGCCGTCACCAAGTTCACCTC
CTCTTAGATACGCCGTTCCCTGTCTTCTTGGTCGGTCGATGCTTCTCTCTGTAATGGTTAGCTGTTCGGGCTATGT*CCC*TGTGTAACTTGTG*CTGGT
GTTGTGGCATCACACTGTTT*CAGTATCT*CGTGAAATAGTAACGATGGTTATTtattcaaaaaaaaaa
page-top