Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14947  (registered. 2002)
Contig Information
Length 674 bp
Clones 15 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 3
Wh_r Root 1
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypoxia induced protein conserved region containing protein [Zea mays]
Score 437
Evalue 1.45164e-41
Total Hit Count 61
Registered year 2002
Contig Sequence     [ Download ]
>Contig14947
ttttttttttaagaGAGAAACATTTCATTCATTACATT*CATGCACGGTTCAGGAAAGCACATATTT*CCATCCCCACGG*ATTT*GCATACGG*CTGCA
TCTAAATGCTGGTTCGG*TAGCTTATACAGAGAACAGGAAGCCTGCAGAACTTGGATAACGGCATGTGAAATGCCAGATTGTTTGCTCAGAAAATAACAT
CAACAAATTCCATATCAGCTAATGGAAGCCTATATTATAACTTGCTGCCTCTTCTACACGGAGTCCTTTTTGGCGTTTCTGTCCGATGGAAGGAACTGCT
TTGCATAGTCGTGAACCTTTGATCCTGAACCTGACTGGTGATCATAGTACTCCACAAGCGCAGAACAACCCAAGGCAGCCAGAGTGAGGGCCTGAGCGTG
AAGCCTGGCGTGGATGAGCTTGACGCTGGTCTTCATCCCGGGCCTGGACCAGTTGTAGGCGATGGATCCCGCGATCCCCGTGAGCCACAGCGTCCCTACG
GCCCGCAGCTTGTGGTCCACGACCCACCCCCTCATCGCCTGCAGCGTCCCCTTCTCCTCCGCCATTCCTTCCGCCGAAAGGGATTCGAAAG*CTTGTGCT
ATCAGATCGAGCT*CTCCGGTTCCAATCTGT*CT*GCGCGTGTGCTtctgagacggtgggctgggtggggtggg
page-top