Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14919  (registered. 2002)
Contig Information
Length 629 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_dL Crown of seedling 4
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H4 [Zea mays]
Score 422
Evalue 6.77141e-40
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14919
gcaggcaattcggcacgagggcAACAaccaCCACCA*CCAGCAACAAAG*CCAAGCTCGCCGG*AG*AGGGAATCGTCGAGG*ATGTCCGGCCGCGGCAA
GGG*AGGGAAGGGGCTGGGCAAGGGCGGCGCCAAGCGCCACCGG*AAGGTGCTCCGCGACAACATCCAGGGCATCACCAAGCCGGCGATCCGGCGGCTGG
CGCGGCGGGGCGGCGTGAAGCGCATCTCGGGGCTCATCTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCCTGGAGAACGTCATCCGCGACGCCGTCAC
CTACACGGAGCACGCCCGCCGCAAGACCGTCACCGCCATGGACGTCGTCTACGCCCTCAAGCGCCAGGGACGCACTCTCTACGGGTTCGGCGGCTAGGCC
GCGCGAATCGATCCCCCCACCACCAGATTTGTGCGCGGCTGTGTAGTGTTCATGGGCTTCGGTGTAATGGCC*GCAT*CTCGCTGCTGTATGTCTTGGCC
TTGACTGTTGTTTGGATGTAGTTCTGAGATGGAATTGAAATTGAAGCAGCTTACCCTTGAATTCTTCTCCAATCTCTCACTCTgttgatgctgatttgtg
tgagcagttagaaattactaaaaaaaaaa
page-top