Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14884  (registered. 2002)
Contig Information
Length 935 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 2
Wh_r Root 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_25404 [Oryza sativa Indica Group]
Score 517
Evalue 1.44924e-50
Total Hit Count 472
Registered year 2002
Contig Sequence     [ Download ]
>Contig14884
gaggaattcggcacgaggcggaggcagagaaggagagcggcagctcgcgcgCGCGCGCCCCCATTGCCGCCGCAGCAGGAGCCCGCCGATTCCAATCCAA
GGAGGAGCTTTGAAGGTTTGTCAGGGCGGGGAAGATGGTTCTCAAGACAGAGCTCTGCCGTTTCAGTGGTGCCAAGATATACCCAGGGAAGGGGATCA*G
ATTCATCCGCTCAGACTCTCAAGTCTTCCTTTTCTCCAACTCAAAGTGCAAGAGCTACTTCCACAACCGTCTCAAGCCAGCTAAGCTTGCATGGACGGCC
ATGTACAGGAAGCAGCACAAGAAGGATATTCATGCTGAGGCTGCAAAGAAGAGGCGCCGCACCACCAAGAGGCCGTATTCCAGGTCAATTGTAGGTGCTT
CCCTTGAAGTTATCCAGAAGAAGAGAGCTGAGAAGCCGGAGGTCCGTGATGCAGCCAGGGAAGCAGCTCTGCGTGAGATCAAGGAGCGCATTAAGAAGAC
CAAGGATGAGAAGAAAGCTAAGAAGGTGGAGGTGACGAAATCCCAGAAGACCGCCGGCAGAGGCAATGCCCCCAAACCCGGGAAGGCCCCCAAGCTTGGC
GGTGGTGGTGGGAAGCGCTAGGTGGCGTCCCTGCCGATCAATGCGAAATTTTGAAC*TAGTTACATGATGTCCTACCCTGTATCTTTTAGGAAGTTTTTG
GCTCAAACCTGCTGTTGCCGTCGGTATGCAGCAT*CTGGGTGCATAAACCGTCGTCAATGTGAGATTGTTTTATGCTTATCTGGTTGTTGTTTCAGCTTT
TCTCTAGTTGGTGTTTCTTCCGCACCACA*TTGTGCGTGTTTGTCTGTCTTCTCCGAAGAACCTTTCTCATGCCCTTGTAACGGTGTTGATCGATGTGGC
GCACTGCCGCCATAATGCGACcttagcggttattc
page-top