Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14838  (registered. 2002)
Contig Information
Length 740 bp
Clones 14 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 11
Wh_h Spike at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pollen allergen-like protein [Triticum aestivum]
Score 478
Evalue 3.18763e-46
Total Hit Count 197
Registered year 2002
Contig Sequence     [ Download ]
>Contig14838
gcAACTACACACATACAGACACACAACAATCAAATTTCAAC*CAGTCTTCGACCAATCGAGAAGATGGCCTCCTCCTCCAGGATGCTCACGGTGGTGGTG
CTGGCGGCGCTGGTCGCCGGTGCGATGTGCGCCGTGAGGGTGAAGTTGACGGTGGAGAAGGGGTCCGACAAAAAGAAGCTGGCGCTCAAGATCGACTACA
CAAGGCCAGGCGACAGCCTGTCAGAGGTGGAGCTCCGGCAGCACGGCTCAGAGGAGTGGCAGCCGTTGACCAAGAAGGGCGACGTGTGGGAGGTCTCGTG
CTCCAAGCCACTGGTTGGCCCCTTCAACTTCCGCTTCTTGTCCAAGAATGGCATGAAGAACGTCTTCGACGAGGTCTTCTCCACCGATTTCAAGATCGGC
AAAACCTACCAACCAGAATATTGATCGATACCGTCCAAGTTTCAGTTGGTCAAGATCGTCGTAATTAATTAATTCCCATGTATGAGTCGCGTTGGAAATA
TGCGCCTGCATGAGTGGATAGTGAATATTTTTTTATGCACATACATGCATATGGTAGGAGAAGCAACGACGGACATGTTTGCTCTCCCATGCATGCATCA
ACTGTCTTTTTTTGTTTTTGGATTATCTTTGG*ATTAGTTTGAATTGCTTACCACATATG*TCAT*GTGGTACATGCATCAACTGTCGATGCAGCAGTTT
T*CTTttgtgtaaccgaatatgctcgagattttagatatt
page-top