Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14806  (registered. 2002)
Contig Information
Length 1449 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_01208 [Oryza sativa Indica Group]
Score 1891
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14806
aattcgttcacgaggccctttcgcagcggcacgctagggtttctcctctccctcttttctcccctcccctcgcgcgctcctccccacccccaGAGCCCCG
TCGCCTAGCTAGGGTTTTTGACTCCCCGCCGCCACCGCCGCGCGCGCGCGAGAGAGAGACCACAGCGACCAACCCAGCCATGTCGGTGCGTCCGAGCGAG
CGGGCCGACGCGCGGCGGAACCGCTACAAGGTGACGGTGGACGCCGATGAGGGGCGGCGGCGGCGCGAGGACAACATGGTGGAGATCCGCAAGAACCGCC
GCGAGGAGAGCCTCCTCAAGAAGCGCCGCGAGGGGCTCCAGGCCCAGGCTCCTATCCCTGCCGCCGGCGTCGAGAAGAAGCTTGAAAGCTTACCTGCTAT
GGTTGGTGGGGTTTATTCCGAGGATAACAACCTGCAGCTTGAGGCAACGACACAATTCCGCAAGTTGCTTTCTATAGAAAGGAGCCCCCCAATCGAAGAA
GTTATCCAATCAGGCGTTGTTCCTCGATTTGTGCAGTTTCTTACTAGAGAGGATTTCCCCCAACTCCAGTTTGAAGCAGCGTGGGCACTCACAAACATTG
CGTCTGGCACATCAGAGAATACCAAGGTTGTCATTGATCATGGGGCAGTTCCAATATTTGTGAAGCTTCTTGCGTCTGGCAGTGATGATGTTCGTGAGCA
GGCTGTCTGGGCATTGGGCAATGTTGCTGGTGACTCCCCAAAGTGCCGCGACCTTGTTCTCGCAAATGGCGCATTGATGCCTCTGCTAGCACAGTTGAAT
GAGCATGCTAAACTCTCCATGTTAAGGAATGCGACCTGGACTTTATCAAATTTCTGCAGAGGAAAGCCACAGCCAGCATTTGATCAGACTAAGCCTGCTC
TGCCAGCACTTGCACGACTTATCCATTCCAATGATGAGGAAGTTTTAACTGATGCATGCTGGGCTCTTTCGTATCTCTCTGATGGCACCAATGACAAGAT
CCAATCTGTGATTGATGCTGGTGTCTGTCCCCGGCTTGTGGAGCTTCTCCTCCATCCATCACCTTCAGTGCTTATACCTGCACTACGAACTGTTGGAAAT
ATTGTCACAGGAGATGACTCGCAAACTCAGTGCATCATTGATCATCAAGCTCTTGGGTGTCTCCTAAGTCTGTTGACACAAAATCACAAGAAAAGCATCA
AGAAAGAGGCCTGCTGGACTGTTTCAAATATCACTGCTGGTAACAAAGATCAGATACAGGCTGTGATTACTGCtgggatTATtggacctCTGGTGCATCT
GCTGCAAACGGCTGAATTCGATATCAAgaaggaggctgcttgggccatctcgaatgctacctccggtggttcccatgaccaaatcaagtatttggttagc
gagggctgcatcaagccactgtgtgacctcctgctttgcccagatccaa
page-top