Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5194  (registered. 2012)
Contig Information
Length 1240 bp
Clones alternative view 59 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_SHC Shoot grown with cold treatment 8
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_SP 19
WH_XA Root 4
WH_XB Root 4
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|90990912|dbj|BAE92901.1|| beta-glucosidase [Triticum aestivum]
Score 493
Evalue 3.00E-137
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5194
ATAATACAAGTTTTCCCTTGACATTAGCTTTTGCCCCTCTTTTTTTTTGAAAAAGGAGGATTGCCCCCGGCCTCTGCATCAGAATGATGTATATAAATAC
ATCATCTATACTATTTTTTTTTTAGAAAACAAGCACACGACCTCACTTTATATAGATAAATCGACGAGTTCCACAAGAACACGATTATCGAATACAAAGG
TTCAGCAAGCAAAAGGGAAATAGTTCGGGCAGGGGCGGCAGCATAGGTAAGCCCGATATAAAGAAGAAGAAAACAAGCTACGGAGCCGGCCGGAGCAGGA
AACAGGTGAGCCACCCTCCGGAGGCCAAGAAGGAGCCCATCCAACCCGCCGCGATCCCGACGACATGCAAACATCCGCCATGGCTACTAGTTCAACATCC
CTGAACTGAAACGGCCACATCCCTTCATTTTATTGCATCCATCCGATTATTAATTTCTTCAAACTGCATGCCATGCATCCAGCCTTGGATTATTTGTTCG
AACATAGCACCACTTCGTTCTCCATCATACGGAAACGGAAGTAACTGTCACCGTTGCGTTGTTATTGGTAGTCTTAAGCAAGCGTTTTGGGACGGAGTTG
AACTTGGCGAACCACTTGGCCGACTTCTTGAGCTTGCGCTTGTTGCCGTCCTTCTTGTCGATGTAGACGAGGCCGAATCGTGAGCTGTAGCCCAGGCTCC
ATTCAAAGTTGTCGATCAGACCCCACGTGAAGTGGCCCCGCACGTCCGCGCCCTGGTCTATTGCGTCCTTGACGGCTGAGATGTGGCGCTGGAGGTAGTC
TAGCCTCTTCCAGTCATCCAAAGGATCTGTCATGGTTGGGTCGCTGTCCACATCAGCAATTCCGTTCTCAGTGATGAAGATGGGTGGGTTTCCGTATTTC
TCCTTCATGATCAGAAGGAGGTCCGTTAGGCCTTTTGGGTACATGTAAATCCAATAAGTCCCGGTAATAGGACCGATGTCATTCCCGTCACTCCCTTTAG
TTTCTGAACTGGCGTAAGCGTCGTCGGTGTTCAGCTTCGGCGTAAAGTCTGATGAAATATCAATATGCTTGGAGAATCTGGAGGTGTAATAGTTGAGCCC
CATGATGTCACATGAGGACGCTAGCTTCTCTTGCTCCTCCTTAGTGAACTTGGGTAGACGATCTCCGATCAGCGATCTCATGGAGAAGGGGTAGTCACCA
CGAACCACTGGCTCCAGGAACCATCCGAGGTTGTAGTCGA
page-top