Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14787  (registered. 2002)
Contig Information
Length 809 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit calmodulin TaCaM2-2 >gi|1755001|gb|AAC49583.1| calmodulin TaCaM2-3
Score 763
Evalue 3.35093e-79
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14787
gcATCTCCGACCCGACTTGCGGCCAATGGCGGACCAGCTCACCGACGACCAGATCGCCGAGTTCAAGGAGGCTTTCAGCCTCTTCGACAAGGATGGGGAC
GGTTGCATTACCACC*AAGGAGCTGGGAACTGTCATGCGTTCCCTGGGGCAGAATCCCACTGAGGCAGAGCTTCAAGACATGATCAATGAGGTGGATGCT
GACGGCAATGGAACAATTGATTTCCCTGAATTCCTCAACCTTATGGCCCGCAAGATGAAGGACACTGATTCTGAGGAAGAGCTCAAGGAGGCATTCCGTG
TGTTTGACAAGGATCAAAATGGTTTTATCTCTGCTGCTGAACTGCGCC*ATGTCATGACCAACCTTGGTGAGAAGTTGACTGATGAGGAGGTTGACGAGA
TGGTCCGTGAGGCTGATGTTGATGGTGATGGCCAGATCAACTATGACGAATTTGTT*AAAGTCATGATGGCCAAGTAAGTTGCATTACCATCTGAGGGAA
GCTTGAGTAATCAGACCACAATATTACCTATCCAGGTGCCATTTTGTGGGATGGCTATTGTATTAAACCGAAAACAATATAACACTGTGCTGTGTCATAT
GTTGTAGGCAATGATTGTTTGCCTTGAAGATTTTATAGATCCTGCTCTGGTCTTTCTGATTTTGTCTGTTCCGTTTTTTTATGTTTGGTTCGTCAACTTT
TCAAGAGTGTAGCCACAATCTGTtaatgaatAACTATATGTCAgtgttccatgattacccctcagtcattgaagtgttatactgtatgtgtgtcnataca
gacatagct
page-top