Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14743  (registered. 2002)
Contig Information
Length 690 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 2
Wh_r Root 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit metallothioneine type2 [Hordeum vulgare subsp. vulgare]
Score 159
Evalue 2.69144e-09
Total Hit Count 6
Registered year 2002
Contig Sequence     [ Download ]
>Contig14743
atgaatagggataaacctcaaaacaaggcagtctgatacagaactcggcaacagaagaagaaaatactgctgcaaatggaaccatagagaagaggaaaac
gacagtttgaggagaagaccaagaacaaaagaccggcctctgatcctgctcgtgcataagaagaacccgaaagcaacactaataggaggaggatctaaca
acacgatgTAAGCAAAACCACGGGAGATTTTATTTAGGGGTTTACATGCATGGCATGGCACCCGCTCTGCTCATGCAGGCAGGTGCGTACATACATACAA
AGACCCTCGATCAGGCAGCGTTACATGGTA*GTAGATGGTA*GATAGACCATAG*ATATGATGCACGCGGCGCATGCATGATCAATGATCTAGCAGCTGC
AGCAGGAGCAGCCGCAGCTGGTGCCGCACTTGCACTGGGTGCAGCCGCAGCCGCCGTTCTCCGCCGCCATCTCCATCCCGCCGGAGCTCGCCTTGTGGGT
GGCAGTGGCGGAGACGAGGAGGGTGGCGCCGGCGGCCTCGACCTCCGGGTACATGTTGCAGCCGCCGCAGCCATTGCCGCACTTGCAGGCGCTGCCGCAG
CCGCAGCTTCCTCCGCAGCAAGACATCTTCGAGGTTGCTTGGGATTGGATGGAGGCTTTGATTGGTGTTGACTAGGAGCTTCCTGTgtgc
page-top