Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14724  (registered. 2002)
Contig Information
Length 943 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 2
Wh_yd Spikelet at late flowering 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195635261|gb|ACG37099.1| spliceosomal protein [Zea mays] >gi|195659375|gb|ACG49155.1| spliceosomal protein [Zea mays]
Score 863
Evalue 1.11034e-90
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14724
ttttttttttaaagtaacagatactTTTAACTTCTtaaacaacAAGTAAgtcactTCCAAGAAATACAGGGTTAGAAAGCCAGCACAAGCACAGCACAGC
AGCTTGAAAGCTTAGGGTTGAAAATCTTACAGTTACAGATTTCTTTTGGCCGGTTCCGAGATCACATGGATTTGTTTCACTTTTTGGCGTATGAGATGGC
CATTGGGTTCTCTGGGCTGATCTTGAAACCCTGGAGGGCTTCCATTGCAACCATGGACTGGTTCTCGTCCTCGTACTCCACAAAAGCAATGCCTGGCTTG
GCTTCGATCATCCGCACCTCCCGGAAACCAGGG*TATTGCTGGAACAGGATCTGGAGCATCATGCTTGTGGTCTGATCCGGCATGTTCTGGAGGAAGAGG
ATGTTGTTCGGCGGAGCAGCTGGCTCTTGCGGAGGCTTGGCAAAACGAGAAGGTTGATGACCAGTTCCATTGCTTGGGGCAACAGGAGCATTAGCACCAG
GTTGTTGTCCAT*CTTCAGTTCGCCGTTTTTTCTCAGCAGCTTTCTCCTCTTGCTTCTTCCTTTTCTCTTTAGGAGCATAAGACCCATCTGCTTTTGCAA
AACAGTCAGACTTTGTTTTTGCATATTGTACCCGCATTTTTTTGCCGTAAAAATCAAAGTCCTGTAGGCCCCGGAAAGCATTGGTAGCCGCTGTAATTTC
ACTGAATGCCACCCAGGCTTGCCCCCTGAGTTTATGAGTTTTCAAGGCCACAACATCCACTATCCTTCCATACTGAGAGCACAATGCATAAAGTGATCTC
TTCAACTCTTCTTTCTTGACCTTCTCGTTGAGGTTCCTGAAGTAGACGGTCTGGTTCGGGGGAACGTCGCCGGACAGCATCGCCGCCGCCGCCGCAGCAG
CCGAAGACGAGGAGGAGAGAGACcttactgtttcgggccgggc
page-top