Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14701  (registered. 2002)
Contig Information
Length 693 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 13
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein Cagg_1422 [Chloroflexus aggregans DSM 9485] >gi|219542591|gb|ACL24329.1| hypothetical protein Cagg_1422 [Chloroflexus aggregans DSM 9485]
Score 81
Evalue 2.95221
Total Hit Count 2
Registered year 2002
Contig Sequence     [ Download ]
>Contig14701
ttttttttttgCGATGAACAGCTCCTTTATTTATACGTACGTAGG*CATAAT*CCACAAG*CTCTTCTTCTATACACCAGCTACAGAAA*G*ACACAGTG
GCATTGTGGCAACGACGG*ACCCAACAAAACTACGAGTAG*AGACTACAGTA*GACTGAACAGAGCCACACAACTAGGATGGCCACCAGTATTCGTACAG
CGGTACGCGGGG*AATGGGTAGAGCAGAGACCGTGCAAGGTGACTGGAAGTCTGGAACGGCGGCTGTTCAGGCGCTCTGGAACACGGCGCCCTTGCGACC
ACGGTAGCGCTTCTTCAGGTTCTTGGCCGCGCGGTACTTGGTGGTGTCTCCCCAGTCGCCTTCCTCCTCTTCCCACGGGTCGTCTCCGCCACGGCCGCCT
TCCTCCTCCTCTCTCCTCCGCCTACGTTCCTCTTCCTCCCTCGGATCGTCTCCTCGTCCTCCTTGGCCTCCGCCGCCCTCTTCCTCCTCCCTCCTCcgcc
tttcctcttcctccctcggatcgtcacctcctccgccgccttcttcctcctccctcctccgccgttcttcctcctcccttggatcatcacctcctcctcc
gccttggcctccgccaccttcttcctcctcccttctcctcctttcttcttcctcttcttgctccctcctcgctgcttcttcctcctccctctc
page-top