Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14695  (registered. 2002)
Contig Information
Length 1858 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_dL Crown of seedling 3
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18030 [Oryza sativa Indica Group]
Score 1545
Evalue 2.39057e-169
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14695
ggccatcGCCCGCCGCCTCCGCCGCCGCCCGCTCCGGCCCGACCCGGCGGGGGAATGGGGAACATGACCCGGTCGGACTCCCCCGTCTCGCGCCGCATCG
TCCTCTCCTTCCTCGACTTCCTCAACTCCGTTGAGTTAGCTCCTGGGGCTGACCCTGAAGCTCTTGAAGTCGCTAAGGATTGCCTGGAGTCCCTTTTTAG
CATCAACTCATCATCAACTAGCGAGAGGATACAGCCAGGACTTCTACTTGAACTCTTTACTTCTCTGCAAGCTAATGAACAAGATAGGGCAAGACCAGAT
CCCGTGTCACGATCAGTGTCAAACAAACCTTCCTGCAGTGCAAGTACTCCCAGTATCCAAGAAGAGTCAAATAAATGTACAACATCAAATAGTGAAGGCC
AAGCGGAAGAAACCTTTGACCTAGATCATGcaggaGATGAGctgtttgCAAAATTctttgccgcGCTTGATGAAATAAatttcttcaagacatcaccagc
tggtgctgaggatcctgatcaactttcaaaagcatcacaattcttcgatgatgcattactggaggtgcgcAAGTCGGGAAGAAAAGTGGCAAGCTTAGTA
GACCTTGCAGAATTCTTTAAATCAAAAGGCAATGACTTCATGAGATCAAAACAACACCTAAAAGCTGTAGAGCTGTACACCGGTGCCATTGCATTGAGCC
GAAAAAATGCCATTTACTATTGTAACAGGGCTGCTGCATATACGCTTCTTAATATGTGCAATGAAGCtgttgAGGACTGCCTGAagtcaattgAAATTGA
TCCGAACTACagcaaagCATATAGCCGActtggatctgcttattttgcaatggggaattttcatgatgctttacacaagggatacttgaaagcctctgaa
cttgagcctggcAATGAAAATGTTCGACTGAATATTGAGGCCACCAAAAGGAAGCTGGCTGAACAGCAAACTGCACCAGGACAGAACACACATGGACCTC
ATTCATGGTTTGGTGGCCAGGCGAGCAGTGGTGCTCCTTTCACAGTATTCCCTCCTGGAAGTGCTCCACCTCCTCCTGAATTCTTCAATATGATGAACCG
TGGGTCTGGTAATGGGCAACAGCCACCTCCGCACTCCGTAAATATAAATCTGAACGACTTCTTTGGTCATGCAAGCGTCAATGGGAATGCCCAAGGACCA
CCGTCCGGGAATCCAGGCACCCATACCCCATCAGCTCCTTTCCCAGCCAGCGCTGGAGTCCCTCCAGCTTTTCCCTTCATGGGCTCAGGCACCGAAGCAA
ACCATGCACAGCAGGCTTCAGGCGGACATGGAGGAGGGCACAGTGAACCAGGTGCCCAGACAGACGCTGGCATCCACATAAATATTGGGGAGAGCATGGT
GAGCCCAGAGCAGGCTGCTGAGGCTCTGAGAGCTGTGATGCAGATGTTTGGACCGCAGATGGGCCCCAATGAAGGCGGTGGTGCGCCTAGAGGGCCACC*
ACC*ACCACCTGGTTCAATCTGATGTGATGTGATGTGATGTGAGAAGTGAAGCCAAAAGGAGTGGAGTGTAATGTTGTTGGTTGTTGTTCATAGTCAGAC
ATGCTGTGTGTTGCCGTGGTTAGCTGCTCATCAACAAGATGTTGTTGTCCTCCTGGTAAATGTTTTGGCTGTTTAGGTGGGTATACATGGTCATGGACCT
GCAGTTGTATCCTGCTGCCATAACCCTCTCTGTCTGCATATGCATATGTGAGAGTCAACAGTCCATGTACCTGCAGAAGATTTCCTAGCTGTCAGTCGCG
TTGAATTCTATTCTTTACCATCGTCGTAAATGAAGTTTTGGCACCGACAGAAGTTacc
page-top