Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14674  (registered. 2002)
Contig Information
Length 1790 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 6
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit methyl binding domain [Zea mays] >gi|22135477|gb|AAM93219.1|AF527618_1 methyl binding domain protein MBD109 [Zea mays]
Score 565
Evalue 9.85315e-56
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14674
gtCGTCAGGTTACAACAACAGCAGCATAAGTATTATGTCTATGTCCTCCTGAG*ATTAATGTGCACTCTAACAAGTTACAAATGATAATAATGACCGAGG
CGGCACAAGCCAGCCTGCTGCCCTGCAGCACCTCATAAGACAACAAGCTGTGAAGTATGCGGAAAGGGCCTACAATTACAGGCGCTGTCAGGTTAAACAC
GCTTACAGTTCTCAAAGCAAACAGAGACCAGGTTTGTTCCCCGTTTCGCCTCGCCTCGCCTGTCGTCCACGGAACCTACCTTCAGATGCACCTCACGGGA
GAAACACCTGGATGAATCTGTCCATTGTTGTCGACGTTCACGGCGGATTGTTCTTCGGGGACGGTGTTGTCTGCTGGATTCTCCGTGGCTTTTGCTGCCT
CTGCCGCTGGAGCATCTGCCTTCACCTCCACTGGAGGAGGGGTCGCCGGATTGATGGTGCTATCTGCCTCTACTTTCTTTTCCTCTGAAGATGCTGGAGG
TGGCACTGTGGATTCGACTGCCATACCGTTTTCACTTTTCTCACCCTCCACGGGAGCTACTTCATATTCAGCTGCCTTCTCATCTTCCTTGTGCTCTTCT
AATACAGGGGCAGACATCTCAAACTCCACGGGGACTTCTTCAGATTCAGCTGGCTTCTCGTTTTCCTTGTTCTCTGATACAAGGTCAGACATCTCAAACT
CCACGGG*AACTTCTTCAAATTCAGCTGGCTTCTCGTTTTCCTTGTTCTCTGTTACAGGGTCAGACATCTCAGCCTCCACGGG*AGCTACTTCAGATTCA
GTTGCCTTACCTTCCACTTCTTCAGTCTTCTCTGGAGCATCAGCGACAGGGGCATCTATCTTCTCTTCTTGAGCAACAGTGTCAG*CCGCTTTCTTCTCT
TCCTGAGCAACAGTGTCAGCCGCTTTCTTCTCTTCCTGAGCAACAGTGTCAGCCGCTTTCTTCTCTTCTTGAGCAACAGTGTCAGCCGCTTTCTTCTCTT
CCTGAGCAACAGTGTCAGCCGCTTTCTTCTC*TTCCTGAGCAACAGTGTCGGTCTCTTTCTTCTCTCCAACCGAACTTCCAGCCTCTTCCTCTTTCTTCT
CTTCCTGAGCACTGTCAGCTTCTTTCATCTCCAGGTCCAGGTCAGTGACTTTGGCTTCTTCAGCATCTTTCATCTCCACTTCAGTGCCTTTGGCTTCTTC
AGCATCAGCATGATCTCCACTTTCAGCTTCTGCGTCCTCTGCATCCTCCTGTTTCCCCTTTTTGCCTTTCTTAGAGCTTGAGGGCCTTCCCCGTTTGGCA
GGCTTCTCATCTTCTGGGCTCTCGGTAGCCTTAGACTTTCCACTTCGGCGTGAGGGTTTCTCGTCTTCTGGGCTCTCAGTAGCCTTAGGCTTTGCACTTA
GACGTGAGGACCGTCTGGGAGTATTGCCAGTTGCCCAGACGAACTCTGAAAGAGCAGGGCCTCCAGGGTGTGCTTTTAGGTAtgtggtTAAAGCTCTCTt
GGtcttgacCTCCTCGCCagttggtgcaacaaaaacaacctcaaacttcccaccccgagtgggattaagcttcttggtccagccggagggggcctggagc
tcctcgccctgctccgcctcgcccgccttcttgagcggcgtctgctcgcccgccgccgccgccgccgccgcgtgctcgccttcgctggccatgctcggag
ctgtttcgagttttcgcttcccgctctcgccgccgccgcaagtgtggatccgcgaggggagggagggttggggcctcgtgccgaattcct
page-top