Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14602  (registered. 2002)
Contig Information
Length 596 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_r Root 2
Wh_yd Spikelet at late flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L44 [Zea mays] >gi|195606184|gb|ACG24922.1| 60S ribosomal protein L44 [Zea mays] >gi|195620316|gb|ACG31988.1| 60S ribosomal protein L44 [Zea mays] >gi|195623550|gb|ACG33605.1| 60S ribosomal protein L44 [Zea mays] >gi|195656257|gb|ACG47596.1| 60S ribosomal protein L44 [Zea mays]
Score 422
Evalue 6.09607e-40
Total Hit Count 322
Registered year 2002
Contig Sequence     [ Download ]
>Contig14602
gaTTCTCCCCCTTCCCCTTTTCCTCACCGCCGCAGGAGAAGAAGCAGACGCGCGGAGGAGAGCTTCCAGGCGGCGACCATGGTGAACGTTCCAAAGACCA
AGAAGACCTACTGCAAGAACAAGGAGTGCAAGAAGCACACCCTCCACAAGGTTACACAATACAAGAAAGGCAAGGATAGTCTTTCTGCTCAGGGCAAGCG
TCGTTATGACCGCAAGCAGTCAGG*ATATGGTGGCCAGACAAAGCCTGTTTTCCACAAGAAGGCCAAG*ACAACAAAGAAGATTGTGCTGAAGCTGCAGT
GCCAGAGCTGCAAGCATTACTCGCAACGCGCCATCAAGAGGTGCAAGCACTTCGAAATCGGTGGAGACAAGAAGGGCAAGGGAACCTCTCTCTTCTAAGC
TGAT*GATACCCCTGTTATGTTCAGAGTGTTGTGCCAGAACTTCCCACTCGAACAATGTATTATCTCGTTAATTT*CTGGGTATGAACTCTATGGGCTAT
GGAGCATTTGTTTTGCCTTTGTGTCAAGTGTCAACTACTCTCGTCAGATCCATGAGACAAGTAAAATGTTCTTTAGGGCATGTACAATGGTGCTat
page-top