Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14587  (registered. 2002)
Contig Information
Length 1151 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 2
Wh_h Spike at heading date 2
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit BAX inhibitor 1 [Hordeum vulgare subsp. vulgare]
Score 1032
Evalue 3.83145e-110
Total Hit Count 299
Registered year 2002
Contig Sequence     [ Download ]
>Contig14587
aagcgtagcctgctcttcgcaaaccaaccaatcgtctcatgattcgattatcgtgacggtaacaggaacacaagAAGAGATCCGGAACGCAGACAGCGTC
TGCAAAAGCTTCATCAGCAGCAGCAAACTCACACAAGGTTCACATGAGCGCGAATTAACAAGGGTGGCACGGCGCCAAGTTACTGCGCCAGCTTAATTCC
TACAAGTACTTAGCAGTGGTGGTGGTACCA*GTAGCGGCGGCGACGATGGTATCTACGATGTGCAGATGACACACGTTCAGGACCTCCTCTTCCTCTTCT
TCTTGTCCTCCGACTTGTCGCCTGCGTTCTTGAGCATGATGATGAGGACGCGGACGAGAACGGCGACGAAGTCGGTGAAGAGGGTGAGCGCGTGCTTGAT
GTAATCCATGTCGCCGTGGTGCGCCCTCTCGATGATCTCCTGCGTGTCGTACACCATGTATCCCAGGAAGATCAACAGGCCAAAGTAAACCTCAAACATG
AAGCTGCCAGAGGAGTGGCCAAAGATGGACGTGGCAAACTGCAGCCAGAGCAGGATCGACAGGCCGGAGGAGAGCAGACCACC*GAGGTACAGGTACTCC
CTGCGCTTGGCGATGATGGCGGCGCCAGAGAAGCACCCGAAGGCGATGGCGGTTCCGACAAACCCTGTCACGAGGATACTTGGGTCAAAGTCTATGGCAA
GCTCAATCAGAGGTCCAACCGAAGCCCCTTCCAGGAGGGCTGCACCCATCAGCAGCCCAAACCTCTTCCTCTCCTCATAGACTGGCACAGAGAACATCCA
GGCGATGGTTCCAACACACGCGAGCATTGTCAGCATCCCACCGATGTTCAGGGCAATGTGCAGGTAAGCACCCAC*GGCAGATGAGGCCAGGGCAAAGCA
TAGGGTCAGGTAAACGAGCTTGAGGTGGGACTGCACGGCGGGGGAGATCTCGCGGAAGTTCTTGAGGGAGTCGTAGCCCCAGCCGCTCGCCGCCGCCGAC
GAGGTCGAGTAGAAGGCGTCCATCTTCCCTGCGCGTCTGTCGAATCGGAGCGGCCTCGCCTCGCACGCAAGGTTGTTCCTCCCTGTCCTGTGCTTGTGCT
TTCGCGTGGATTTTTCTCCTTTTCTTTTCTTCTTCTTCCGCTGCTTAGGat
page-top