Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14566  (registered. 2002)
Contig Information
Length 722 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 6
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_r Root 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0223400 [Oryza sativa (japonica cultivar-group)] >gi|121332|sp|P14654|GLN12_ORYSJ RecName: Full=Glutamine synthetase cytosolic isozyme 1-2; AltName: Full=OsGS1;2; AltName: Full=Glutamine synthetase root isozyme; AltName: Full=Glutamate--ammonia ligase GLN1;2; Short=OsGLN1;2 >gi|20358|emb|CAA32460.1| unnamed protein product [Oryza sativa (japonica cultivar-group)] >gi|56541421|dbj|BAD77931.1| cytosolic glutamine synthetase 1;2 [Oryza sativa Japonica Group] >gi|108706922|gb|ABF94717.1| Glutamine synthetase root isozyme 5, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547895|dbj|BAF11338.1| Os03g0223400 [Oryza sativa (japonica cultivar-group)] >gi|215769188|dbj|BAH01417.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218192361|gb|EEC74788.1| hypothetical protein OsI_10575 [Oryza sativa Indica Group]
Score 581
Evalue 2.4797e-85
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14566
acgaggtcctcgtgccgaatcggcacgaggtctcatctcatcatCGTCTTCCCCCCATTGCCATTCCCTCCTTGCGAGTAGTAGCAGCAGCAATGGCCAG
CCTCGCCGACCTCGTCAACCTCGACCTCAGCGACTGCACCGACAAGATCATCGTCGAGTACCTCTGGGTTGGAGGATCCGGTATCGACATCAGGAGCAAA
GCAAGGACGGTGAACGGCCCCATCACCGACGCGAGCCAGCTGCCccaAGTGGAACTACGACGGCTCCAGCA*CCGGCCAGGCTCCCGGAGAGGACAGCGA
AGTCATCCTCTACCCCCAGGCCATTTTCAAGGACCCGTTCAGGAGGGGTGACAACCTCCTTGTTATGTGCGACTGCTACACACCACAAGGTGTTCCAATC
CCCACTAACAAGAGGCACAATGCTGCCAAGATCTTCAACACCCCGAATGTTGCAGCTGAGGAGACATGGTATGGTATCGAGCAGGAGTACACTCTCCTCC
AGAAGGACGTGAACTGGCCCCTTGGCTGGCCCATTGGTGGCTACCCTGGTCCTCAGGGACCCTACTACTGCGCGGCCGGCGCGGACAAGGCGTTCGGGCG
TGACATCGTTGACGCGCACTACAAGGCGTGCCTCTACGCCGGGATCAACATCAGCGGCATCAACGGGGGAGGTCATGCCCGGCCAGTGGGAGTTCCAAGT
CGGGCCGTCCGtggggatcgcc
page-top