Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14552  (registered. 2002)
Contig Information
Length 1359 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 4
Wh_oh Pistil at heading date 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0824300 [Oryza sativa (japonica cultivar-group)] >gi|48716318|dbj|BAD22931.1| putative AT-hook protein 1 [Oryza sativa Japonica Group] >gi|48717090|dbj|BAD22863.1| putative AT-hook protein 1 [Oryza sativa Japonica Group] >gi|113538105|dbj|BAF10488.1| Os02g0824300 [Oryza sativa (japonica cultivar-group)] >gi|125541688|gb|EAY88083.1| hypothetical protein OsI_09514 [Oryza sativa Indica Group] >gi|125584210|gb|EAZ25141.1| hypothetical protein OsJ_008624 [Oryza sativa (japonica cultivar-group)]
Score 841
Evalue 6.75725e-88
Total Hit Count 245
Registered year 2002
Contig Sequence     [ Download ]
>Contig14552
ttttttttttaaaatacccaggTTTTTCCTCCTTACT*CTTCCTGTATAGGTAGGTACTAGGATCCATCGTCATCCCTTCTCTAATACAACATCGCAGTA
CAATGACCAATACTATGATCAATCGATATGCAGGGTTTCGTTCCTAAAACAGCAGCAGCAGCAGCAGTCTCCAACAACACCGCAATCTACAATAGGCCCG
GTACATGATGCTTGCTGTGTGGTCACTCAAAGGGACGATCTCATCTCATCTGATCTGGGGTCGAGAAGTGGTCTCGACCACTCTGGCGATGAGCTACTCG
CGGATCGAGTTGATGT*CGATGCTGGAGGACCTCGAGTCCATCTGCCGCATCAGGCCGGGCTGCCACCCGCCCATGGGGCGGGGCGGCGGCATGTTCATG
TTATGCTCGGGGTCCATGTCGTCCTCCGGATGCGCCATTGCAAGGGGCTCTTCGCCGCCGGCGCCGCCACCG***TTGCGCTC******CTCCATTTCTT
GCTCCGCTTTGGTCTGGTTTTGCT***TTGACAAGCTGCCGTACATGGGAGACGATCTCAGGTCCATCTGGTTCATCAGGCCGGGCGGCCATCCGCTCAT
CGGGTGGGGCGGCATGTTGTGGGGGTGCTCCGGCAGCGCCAACGTGGGAGTCTCTtccccgccgCCGCCACCGTTCTGCTCTTCGTTCTCCACGTCTTGG
TCCGCTTTGCCTTTGTTCTTCTTTGACCCGCCACCGTACATGAAGCTTCCCACTATCACCTGAACAGTTCCAGCTGCTGTCAGGACTCCACTAACACT*C
CCACCGATAACCCTGTGGTCAGGGCCACACAAAGCTATGCAAAGGCCTCCACTTCGAGTGCGGGTACCACCTTCTTCTACCACCAAATATGATCCAGAAA
GACACAGGATTTCAAATCGACCCTCATATGTCACCACACCGGAGTCTGAATCCTGATGAAGGGTTGCCGTGGAGACAGCCCCTGTTGCTGAGATGATGCA
AATAGCTCTTGGGCCTTGTTGTGAGAAGGACATTATTCTGGCGGCAACATCCTCtccggctgaAATAATAATCacgtgAGGAGtaaaccctgtTCCAACA
GAGCCAAGAAACCATTTTCCAagcgaAGCCAGCTGCTGCATCTTCCCGGACCCAGGTGGCCGCCCTCTGCCACGTTTCTCCGTCAGTGCgcctgaACCAG
AACCCCCTGaccctgtCCCCGGCCCAAATCCTGAGCCAGgtgtgGTAACCatcgcGCCCATTCCTGGGCTCGACGAATGAGGCGTGGATGGAGATGGCGA
GAGCCCcaacgTCACCGACCCATCAGGCTTATActtccttggcctcccgcgctttttcc
page-top