Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5166  (registered. 2012)
Contig Information
Length 743 bp
Clones alternative view 92 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 6
Wh_e Seed DPA10 3
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_r Root 10
Wh_yd Spikelet at late flowering 20
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 7
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 8
Wh_VSCB Liquid cultured tissue 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_SP 5
WH_XA Root 3
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122044864|sp|P05621.2|H2B2_WHEAT|H2B2_WHEAT RecName: Full=Histone H2B.2
Score 285
Evalue 3.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5166
TTTTTTTTTTAGTAAGAACATCACTGTCACAGATGTAGTAGTACCACAACCGCAACATTTTTTAGATAGATTTCAGTTTGCAAAAGCAACACGTTCAGTT
CTCACAACCAAGAAGCCAACAAAGCGTTGGCAATCTTCTACCACACGAACTACTACTTCTACTTGCAGATACATCAGACAGCCACATCTGTCACAACAAG
CGACGCATCGTCAGTCTAGGAGGAGGTGAACTTGGTGACGGCCTTGGTGCCCTCGGAGACGGCGTGCTTGGCGAGCTCCCCGGGGAGGACGAGGCGGACG
GAGGTCTGGATCTCCCGGGAGGTGATGGTGGGCTTCTTGTTGTAGCGGGCCAGCTTGGCGGACTCCCCGGCGAGCTTCTCGAAGATGTCGTTGATGAAGG
AGTTCATGATGGACATGGCCTTGGAGGAGATGCCGATGTCAGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATCTTGTACGTCTCCACGCCCTTCTT
CGCCTTGCTGCCCTTCTTGCGGCCCCGGGTCTTGCCCTCGCCGCCGGCCTCCTTGGACGCCGTCTTGCCCGCCGGCAGCCGCTTCTCGGCCTTGGGCTTC
TTGCCCGCGGGGGTCTTCTCCGTCGCCTTCTCGACCTTGTTCTCCGCGGCCGGCTTCTTGTCTGCCTTGGGGGCCATGGCTGCCGCTTCGGGTGGGGTTG
GGAGCTTCGGTGGTGGGGGCTGTGAGTTTGCTGGAGGCAGGGG
page-top