Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14513  (registered. 2002)
Contig Information
Length 1057 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_SL Seed DPA30 4
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11566 [Oryza sativa Indica Group]
Score 799
Evalue 3.537e-83
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14513
ttttttttttaacaacagataaatatattactACTCGACAGAATGAACATACTGGCAGATGTTATAGATGAGAGCACAGCATTGGGCCTCTTAAAGTGAC
TGCTCACCACTTGCAAGTTTCGAATTGTAGGGTTCGTCGCTGCTAATCCTAATGTGGCATTCCATTCTACATGAACGGCAAGTCCCAAAACTTTCAGACA
ACGATGATAGTACAGCATTACACCACAAATTTCCGGCGTATCTCCATGCCGCTCACTCGTCAGCGTGCTTCTTCTTTTTCTTCTTCTCCTTCTTGGCAGA
CACGTCAACCTCCATGGGGGCGTCCTCAGCGTCTGATTTCTTCTTCTTTTTCTTCTTCTCACCGTCGGTGTTGGCTGCAGGGGTGTCCTCGGCCTCCTTG
CTCTTCTTTTTCTTCTTCTTCTCGCTAGCGTCGGTGACGGCTGCTGGAGTCTCCTCGATGTCCTTGGATTTCTTCTTCTTCTTCTTGGACTTCTCTTTCT
CCTGCTCGCCGTCCTGTTCAGCTGCCTCCGCAGTAGGTTCTTCCTCTTGGTGCTTCCTCTTCTTTGAAGCAACTTCTGACTTCTTTGGCGTTTCTTCAGT
GGTTTGTCCAAGCACTAGATCTGCTGCTGAGTTGTAAGTTTTAGCGGGAGTGATCAGAGCACCACCACCCTTCCGGTCCTTTTCATACGCTTCTATCTTG
GGCTTTCCTTTCGTGGAACCAGCAGACCTCCCAAGTTCCTTACCCTCAAGAACTCGAAGCCGTGTTTCAAGCTTGATCCTGCTTTCAAGACCCATGGAGT
TATCGTCACCGTCAGCAAGGGCATCATATCTTATGGCAAGTGCACTCTTAGCAGCAAGCGAGCGAGAGATCTTTCCCTTGTGCTTCGGAGCCGCCTGTCC
AATTAATGATGCATGATAGATGAGACCATACTTTGGTGTGGCATGCTTTGTCTTCagagctctgaataaggccttctctgcccccagaatctgaatcgtg
ctgccaggctgcttcgccagattcatcaaactaccaccatgggaaataaggcgagca
page-top