Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5163  (registered. 2012)
Contig Information
Length 862 bp
Clones alternative view 90 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_SH - 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 7
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_CA 1
WH_SP 1
WH_XA Root 7
WH_XB Root 15
WH_XC Root, treated at 50 microM Al for 6h 11
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|42541150|gb|AAS19468.1|| delta tonoplast intrinsic protein TIP2;1 [Triticum aestivum]
Score 358
Evalue 3.00E-97
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5163
ACACAAACAGAGAAAATTCGGGAAAAAAAAGTACAAACAGAGAAGGATCACAGCGATTTTTTTGATGCACTAAACAATGATGTTCTTATTGAATCGCATA
AGGAAACTCAACTGAAGAATTCTCAAACCCCACCAACTTCACAACATCACATTTTACAGATAAAGGAACATGCATCATCCAGCTACAGCTTCGATCTGAA
CCAAACAACAGGATGTTCTTCACATCATCGAGACATTCGTGAGACTGCCCACCACGTACGCACTTTTTATGTTGCCGAAGGCATTATGGACCGAACGACT
CTTCCCATGGCTGGCTTAGTAGTCGTTGCCGGCGACGGGGCTGTGGTCGTCGCACATGTATAGGTATCGGTAGACGACGCCGGCGAGGCCACCGCCGATG
AGCGGGCCGGCCCAGTAGACCCAGATGTTGGTGAAGTCGCCGCTGGCAACGGCGGGGCCGAAGGAGCGTGCAGGGTTCATGGACCCGCCGGAGAAGGGGC
CGGCCACGAGGATGTTGGCGCCGACGATGAAGCCGATGGCGATGGGGGCGATGGTGCCGAGGGATCCCTTCTTGGGGTCGGCGGCGGTGGCGTACACGGT
GTAGACGAGCCCGAAGGTGACGATGATCTCCATCACGACGCCCTCAAAGGCGCCCACGCCGGAAAGCCCGTGTGTAGGGGTGGCCACGCCGGTGCAGAAC
TGGACGAGGAAGGCGCCGACGATGGCGCCGAGGAGCTGGGCAACCCAGTAGAAGATGCCGGTGAGGATGGTGATCTGGCCGCCGAGGGCGAGGCCGAAGG
TGACGGCAGGGTTCACATGGCCGCCNNNNNNNTTGGCGCCGATGGCGACCGCGACGAACAGC
page-top