Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5162  (registered. 2012)
Contig Information
Length 844 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222619079|gb|EEE55211.1|| hypothetical protein OsJ_03068 [Oryza sativa Japonica Group]
Score 340
Evalue 1.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5162
TGATACACATTTCAAATAGCTATGTATATTTTTACATGAAATAGCTGTGTATATTATGAACGTAAGAATCTTGCTCGAAAATGGTCTTTCGGAACCGTTG
AACACAGAAGGCAGGACTGTCGGTATTTGTGTACAGGTACACTTGTATACTGTATACTTTGGCATGGATGCTAAGCCTTTAGTGCAGGCAGGATGCACCT
GACAGGATGAAGGTCAGGCTCATGTCCATTTTTACAGATTATAGCACCAGACCTAGTAAATTGCACGCTATGCTTGACAAAAATGACTGGCTATGGGATG
AAAAAATATGGTAGCTATTCTACACAAGGTTCTGTAAGACTATATTTACAAAAGACAAAAACTAAAAAAGAAAGAATATTCCCCTCGCTAGTTCGGGGTA
GAACAATCTGCCGTATCAGTTTTGATAACTCTGGTATTGTAAGAACCACAGGAGCCGCATTTGTGGTACAGCCAATGAAACTGAGATCTCCCTTTTCTTT
CACAGTCATTACAAAGAATGTCCTGACACCTATCGCGGTATTCCTCCGGAAGCTCTTCAGCAGCCAACAACGCATCAAGCATGCCAAAGTACACCGCCAT
ATCTCCCAAGGATTTGCAGCAGATAGGACAAGTGTAGTGACTGCAAGTGTATGCCTGAAAGCAAGCTGAATGCATGAAGTGACCACAAGGAAGAGCTCTA
ACTGCCGCGCTTGATGTGAATAGGAAGTCACAGCAGATTGGACAGTTTGTCTCTAGCCCCTTCTCCCGACATTTGTGTTCTGTTAGTTTCATTCCAAGGC
AGCAATTGCACTTCATGCAATGGAAGAAATCAACACCAAGACCT
page-top