Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14471  (registered. 2002)
Contig Information
Length 1095 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit CRC-related protein [Triticum aestivum]
Score 1038
Evalue 7.18743e-111
Total Hit Count 284
Registered year 2002
Contig Sequence     [ Download ]
>Contig14471
aattgcgatgaaaaaatattataaggtagcAGCTgttcataATTAAAGGGTGCGTACGTACGCTCCAACAACAAATATAACAGACAACACCAT*CAACTT
AACGACACAGCAACAGCAGCAACGAAGTAACCAAACATAAATTAAACGCGTGCGCTTATGCATTATATATATGCATAGCGACGGATGATGATGATGAGCT
AGCTGATAAGTAACCGATGCATGCGGTAGCAGTACTAATTAATTCCAGCATGCTTGTGATGCCTTAGGCGCTGCGCTCCATCTGCTTGAAGATGTCGAAG
CTCTCAACGACTTGCTCGGTGGCCCTCTCCTGCAGCtacgtccccatgtatattacCTGAGGACCGGGCACTACTATTCTGGGCTCTGGGGCGCTGTTGG
AAGCAGAGACAGTCGATGAGCAGCGAGGGTCGCACTTCGCCCAGTTCTTAGCAGCCATGCTGAAGGCTTCTCTGTGAGGGATGTCTGGCTTTGCAGCTTT
GATACGTTGTATTTCCTCCCTCATGAAGCGATTGTAGGCAGATGGTAGGCGATGTTTCTTCTCTGGGGGCTTCACAACAAAGGGAGCTCTGGGGCTGGCA
TCACTTGATGTCGGCGAGGCCAGCGGTGGCAGCGGCTGGTTCCTCCTGCAGTCAGTGCATCCCTGGAACGGCCCCATGGGGTGG*TGG*TGGTCATTTGG
GGAGAGGGGCTGCACCATGGGCGGCGGCCGTGGGCTGAGAAAGGAGAGGTTGTTGCAGTGGCCGCATTTCACAGTCACCGTGTCCATCAGCCTCTTGCAT
GGAACCCCAACctgcagCGCGAGCACGGTGTTGCAGTACGTGCAGCGCACGTAGCAGAGGTGCTCGGACGGCGACACCAAATCCATGCTCTGCATGCTCG
CTAGCCAACGGACGACGGGTCGTT*CCGGCGGTGGGTGGCCGGCGTCGGTGGGACGGAGAGGTCAAGAGTGAGCTTGGGCGCGCGCGAAGAGCCAACAGA
AGACGAGGATGTGGAGGGTAGGAGGGTGGGAGGTAGAAGAAGAAGAagaagaagaagaagaagaaggtggaggagggggacgacctcgtgccgaa
page-top