Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14415  (registered. 2002)
Contig Information
Length 676 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DNA-binding protein S1FA [Triticum aestivum]
Score 479
Evalue 2.00042e-46
Total Hit Count 19
Registered year 2002
Contig Sequence     [ Download ]
>Contig14415
acaacataccaactgcaaacggcaACACAGGTTTCGCAAGTTTGCCACAGATGATCCCCAGCAAAGTTTTAAATTTATAAAAACTATAACC*AGG*AGCA
GCTCAATTCAGACTAAGGTTTATCAGTTCGCTTAAATAAGGTGTCCAATACCGACGATGTACCACTCAAG*ACAAGGTTTCTACATAAACAGTAGCTCAA
CACCGCAGCTCCAGCTGGTATATATTTTTTATCAGGTAAAGAGGAGCCCAGCATAAAGCAATCGACACGCGAAATCGATGGATCTCTTCACTCCCCTGGT
GCAGAAACCCCTTGCTTCAGCTTTTCCCTCTTGAGCTTCTTCTTGGAGACTGGCTTCTTCTTCTTCGGAGGGAGCGTCTTCTGCGCATACAGGTACAGCG
CATAGTTCCCAACAAAGAAAAGCAGCAGGGTGGTAGCAACCACAAGCAGGACTATCATTCCAGGGTTCAGGCCCTTGTTCACCTCTTCGATGATTACATT
GTTCGCTGACTCCGCGAACTTCTCCGCCATGGCGGCCACGAGATCTGGACCAGGCACCGCGCCCTCCTCGCCTTCTGAACCGAGAGATTGGATGGATTAG
GCCAGGGGCGAGTAGGAGATAAGCACt*ggaGTTCTTCGAGGAGgatgggtTCGTAAGat*ctGTGGGTTCCAgcc
page-top