Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14393  (registered. 2002)
Contig Information
Length 1039 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit dolichyldiphosphatase 1 [Zea mays]
Score 497
Evalue 3.42148e-95
Total Hit Count 105
Registered year 2002
Contig Sequence     [ Download ]
>Contig14393
aatatatggcacagatataattagtcgagtacaaaaaagctGTGGTCTTTGTCCAAATGTAAACGAAAATCAACTCATCGCCAAATGAATACAAGGGT*C
TGGGGTTAAAAAG*AACAATGGCTTATGGCCAGGAAAAGCAAAAAAAACACCACAACTCCAATGGGCTTCTCTTCTAATAAAAGTCCAGCTAGGAGTACA
TGGGTTCGCGTGCAGCTT*CAACGAAGCAAACATCTTGCCATGCCACACAAGTTCTTACCCTCCCTGAGATAGACCAACCATATAATCCATGAGCAGAAA
CCTGCAATCCTCAATCAGTAGCAACTTTCTTCCTTGCTGCCCTTGCATTATCATACTCAAACTTGAGCACATCTTGAATATGTGAAGTATCCTTGATATA
AAACCACCTCCCAATTGCGCTCTCCTCAATCATTGGGAAGTATTGAGCAAGAATGGTGTTGACGAACCAGTACCAGATAGCACCAAATACAAGGCCGACT
ACTGCTCCCGCGAAAACCTGCGGGACGGTGTGGTAGCC*GAGATACACCCTGGAGAGCATGGTGAGGAACGCGAGAGGCCATGAGAAGGAGGCCATGACG
CGGCTCGCCGGCGACCGCCGGAGCACGAAGAGCGAGAGGTAGGTGGCGAAGAAGAAGGTGTACTGGCGCGTGGCT*GGACGGCCAGCCGTGGGAGTCGCA
GGTCTCGAGCAGCTCGCACGAGGCCGGGCGGGACTGCGCGACGGAGTGCTTGATGAGCTCGTTGAGGACCTGCGAGACGAGGAGCCCCAAGGCGAAGCAG
ATGCCCTGCAGCTCGCGGCGGAACATGAAGTGGGAGATGAAGCCGCCGAGGCTGATGAAGACGGGGATTAGGGAGACCCACGCGAGGAAGAGGCCGACCC
TGTCGCCCCGGTGGTAGCGGACGTGGGTGAGCGTGATGGCCTTGAGCGCCGGCGGCACCGACGCGGCCATCTCCTGGTACTCCCCCGCGCCGGACATGGC
TCCGCCGCAGAGCTTTCTctttttcctctcttcttcgat
page-top