Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14392  (registered. 2002)
Contig Information
Length 1521 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_yf Spikelet at early flowering 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 96
Evalue 0.195009
Total Hit Count 1
Registered year 2002
Contig Sequence     [ Download ]
>Contig14392
aaagatagcctagCCGATCGACAAACAAAAATTCTGCATCCCACTGAACAACACTATTATGCAAGAGCTTGAAGCTTTGGAGCCAAGGCTATGAACCTTA
AAATCTAACAGAACATCTTACCATGCAAACACGGTAAAATGGGAAAGAAAGATTCTAAATGTGACGCACCAAAAGCGGAAGAAAATGTTGAACGGCCTGG
GCGTGCGGAGTTGTGCCGGTGACCTGGTGACGCCGAGCAACGCGTGTATGTGGACCAGCCTGATGACGGTGGCGGCGGCGCCCTCCTCGTCGACCTTCAG
CAGCTCGCCAGAGTCTGCAATGCTCATACTTTGCATCGAGTAAACCCATCTCACTAAGAACGGGAATGAGCATCGCCTTTGGCATGATCTTGATAGCATC
CGCTTCCTGTCTGCTGAATAGTGAGCATTTGACCGACAGGCAAACAACGCAAACATTGAGGAGGTTAACAGGGGCACCAAGAGTTGTTCGCAGCCTCGCT
GATGGAGGCGACTTATTTCTTCAGATTTATTTCATACGCCTCCTCAATCATCATGGTACATACATCTCTGAAAATTCTTCAACCACACCAGGCAAGAAGC
AGCCCACCAAACAATGAAGGCGTGCATCACACCAGCGACAATTATTCATTGGAACACTAAGCGGCTTCCAAGAAGATATATTAAAGTGTCTATCATGTAG
CCCAACCAATTGCCTTATCAGCTGTTGATTTGGTTACCGCAGTTCGGTCTTTTCCCTCATGTGAGTTCTGCGCCATCCTTACATGATTCAGCACCAGCGA
CCTAGAAACGATCATGCTCTTTGATTTCTTCTTGGACCCATGTTTCCTATCACCAGTCCCCTCCCTGCAGCACAAATCCTCGCTGATCTCTGCAAATCTT
CAAAAGTAAGCATCAAAATAACCAACATGTACCTCATCGCGGGGAAGAAAAATCCGGGGATACCAAAATCGTTCAGGAATTTTTCCTGTGGACCTGTTTA
TTGCGAGTCCATAAGGCGAGCAAGATTTTCTCTTCCT*CCTGCTTGTCTCCTTCCTCATCCT*CCCTGTCTCCTCCCACTCCTGCTGGCCAAGACAACAA
ATCCAAGCATCAAAGTTGGAAACCAAAAGGAAAGCAGACAGCAGGGAGATGCCAGCATGAGAACCAAATCGAACAAGAATATCTCCTTCTCCTCCTGCTA
GTCTCCTTCCTCCTCATCCGTGGCCCCTTCTGCTCCTCCTGCTCCTCCCTGCAGCTCCCATGACGGCACAGTCGGGCTGGGAAGCCTTCCTGACCATCCC
TGCCGTCGGGCGACCTGCGCGTGAGCGATGGGAAGGCGAGGAGGAGGAAGAGGCGAGGCGGTGGAGGAGTAGCAGTCGGCGGCGGGGCT*CCTAGGGCGC
AGGAGGAGGAGGTGGGAGGGAGTGGCGGCGGACGAAGGAGGGAGGagcgaGGGGCGCGGACGAGGGAGGGAGGAGCGAGGGGCGCGGGGCTGTGGattgg
ggctagggttagggagcggcc
page-top