Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14353  (registered. 2002)
Contig Information
Length 646 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 3
Wh_r Root 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Rpr4901.2 [Hordeum vulgare subsp. vulgare]
Score 273
Evalue 1.3996e-22
Total Hit Count 24
Registered year 2002
Contig Sequence     [ Download ]
>Contig14353
gcATCTCTCTCCCTCTAGCAGCGACCTGACTATATAGCACGGCAGGCCGGTCGTCGTCTCGCCGGGAGAGAATAGGCACAGCACAGGAGAGAGAGGGAAG
CAGCTGATCCCAGCCGGAGAACCGTCCATCCGCCATGAGCGACGGGCAGGGCAATGCTCCTCCCGGAGGCTACTTCATCGGCCGTCCGGCGAACACCGAC
GAGCCCAAGGAGAAAGAACCGCCGCAGGCCGTCGCTGAACCTGCTCCAGCTGCGCTGCCTACTCCTGGTGATTACTTCGTCGGCCGTCCGGAGAACCAAC
GGCAGAACACGGAAACGCCGGCGCCTAAACCGGGCTTCCTTGCCAAATTCTGTCCATGCCTCGGCGGTAGTGGAGCTACCAGCTAGACCGACAAGCCCAG
CCGCCGTGCGCCGTGCGCGTGACCACGGGAGGATTTGAAGTGGAATCGGGTCCATGAGTCTCAATTCTGTATTGGAACTGTGCGAGTTCTCTTCAT*CTT
TGGAAGCT*CTGCTCTGTTTTTCCTTC*TTTCACTAGCATTTGATTCCTCCATATTCATTCGTGTAACGCCGACAAACGTAAACTCGACGAAATTGCCAT
CCGTCCCTGTGAAATGAAAATGGTGTTGatttgttcaaaaaaaaaa
page-top