Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14330  (registered. 2002)
Contig Information
Length 975 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 27K protein [Triticum aestivum]
Score 1118
Evalue 3.16414e-120
Total Hit Count 246
Registered year 2002
Contig Sequence     [ Download ]
>Contig14330
ctTTCTATGCTGAATGTTTTTTTCTAAACGGAGTACATTGTACTCCAGGATCGGGCTATTGATTCCTCCACATGTCAACCCAGCAAACCAGATCAATCTA
AGAGCACAACCACTTGATTTATTAACCTTAACAGAGAGATTGAACTGCCCTATGTTCAGATGTATGATCCCCGAGAGGAAACATAAATTTATCAATCATT
ATTATCACCATCCGGCAGGACCATCCTAATCTTGGCGATGGCATCATCATCATCACGATCAAAGTCGGCCGTACACATCGTCGTGTGCCTCCAGGCCCAG
GCTTCGACACGCCTCGAGGAGGGGATAGCCCTTGTACGCCTTGCAGATGTAAGCTTTGAAGTTCCCGTAATCGTTGTAGAGCGGCTTGC*CGT*CG*AC*
CACCACCCATGGAACGAACTGGTGAGGAGGCACGAGCTCAGCTGTCTGTCTCCCATACTCGAGCGATAGATTGTGGCCACGCTCGCCCTTGTAGCACTCC
GTGACTGGCTTTGGGTCAAGCCCCTGTTTCTGGAAGCACGACTCCCACTCCCGGTGCTTGTTCTTCAACACCAGGTCCGACACGCAGTAAATGAAGCCGA
GATGCACCTT*CACGTCCGGCCAGGCGT*CGATGGCGCAAGCCTCCACGGTGTTGAGAAGGCATTCCTCGGGGCCATGCTGACAGGAGATGGTGCCGTCA
TTGCGGACCACGGCGTTGCCATAGGGGACGAGGGTGAGATTGGCGGCGTCGAGCAGGCCGTCCCTGTAGGCCTTGAAGAGGTGGTTCGCCACGAAGCGGA
CCGAGTAGGGGCACAGCGACTCGTAGTAGATCGCCACGTGCACCTTCTCGCTGCCCCTGCCAGTGGCGACGTCGCCGGCCGTCGCCGCGGAGGTGGCCGA
AAGCAGCTGGAGGAGCGCTGCGAGGAGCAGGAGATGGCGGAGGCCGCGCGCCATGGTGTtcgcctcgtgccgaat
page-top