Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14328  (registered. 2002)
Contig Information
Length 917 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_r Root 3
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit acetyltransferase [Bacillus anthracis str. Ames] >gi|47528886|ref|YP_020235.1| acetyltransferase [Bacillus anthracis str. 'Ames Ancestor'] >gi|49186344|ref|YP_029596.1| acetyltransferase [Bacillus anthracis str. Sterne] >gi|65320821|ref|ZP_00393780.1| COG0110: Acetyltransferase (isoleucine patch superfamily) [Bacillus anthracis str. A2012] >gi|165871010|ref|ZP_02215661.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0488] >gi|167636274|ref|ZP_02394576.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0442] >gi|167640579|ref|ZP_02398841.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0193] >gi|170688402|ref|ZP_02879610.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0465] >gi|170708106|ref|ZP_02898553.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0389] >gi|177652410|ref|ZP_02934877.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0174] >gi|190565086|ref|ZP_03018007.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis Tsiankovskii-I] >gi|30258128|gb|AAP27356.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. Ames] >gi|47504034|gb|AAT32710.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. 'Ames Ancestor'] >gi|49180271|gb|AAT55647.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. Sterne] >gi|164713221|gb|EDR18747.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0488] >gi|167511447|gb|EDR86831.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0193] >gi|167528297|gb|EDR91069.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0442] >gi|170126914|gb|EDS95794.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0389] >gi|170667572|gb|EDT18327.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0465] >gi|172082084|gb|EDT67151.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis str. A0174] >gi|190564403|gb|EDV18367.1| acetyltransferase, CYSE/LACA/LPXA/NODL family [Bacillus anthracis Tsiankovskii-I]
Score 86
Evalue 1.34401
Total Hit Count 41
Registered year 2002
Contig Sequence     [ Download ]
>Contig14328
ggaAGGGTCCGAAGGACCCGTCTCCTTGATAAGCATGATAGTACATTTTACAACAGGACCCCATGGCAAACAGAAAACTACGAACTAGGTCCTGCATTAT
GCAAACAAGACCCTGAACAAGGGAAGAAGATTGCAATCGGGTCCGAACTATCTGCACCCCGATGGATTCAGCCTCGCCGGCGCCGGGGACGGCACCACTT
GGGCCAACGAGACCTCCATGACTCCATGCCATAGACTCCACCGTTAAGCAAGACTGCCTCCCCTTTGGCATCTTGGCCGGGAGGAATGAAGATGGTCGCC
CTTCGACCTGAGAATACGGCGGGTCGTCAGAGACCAGGCAGCAACCAAGAAGGGCGCCACAGCCTCTCGAAATCCACCGCCGTGTGTGCTCACGGACCCC
AACCGCAGTGTCCATCTTCCCCTGTGAGCGACGCCACTTCTCCATCACCATGATGGATGCTGTAGACAGCAGCTTGGTGGAGATCCCTTTGCAGATCCGA
CCAGGACTACCTCGCTGGAAGCTAGGATCCAGCGAGAACATGCACCCAGGATTCGAACCCCGCCGTGTTCTCCCGCAGGTTCCACTGCCGCCACCGAGAC
GGCACGAAGAAAATAGGGAGGACACTGGATCGGCTCGATCTGAGGCAGCCGCACACTTATTGAAAGAGCTAGCGCCAGATCCGTCGACTTCCCTTCGCAT
CCACCATGGAGGAAGAGCAGAGGACGGCGCCGGCGACCACCGAGCGCTGCACGCATGCGACGGTGGGATGCACTCCA*ACGGCATAACGCCAGTCGCCCA
AAAGGGAAGTCCAGGCAAACACCTCAGTCCtaagctactatatacaggaagagaacggcctcctctcccactccatctccggccggcaaagccgccgaag
aaagaggagagaggagc
page-top