Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14299  (registered. 2002)
Contig Information
Length 679 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_r Root 3
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11358 [Oryza sativa Indica Group]
Score 651
Evalue 2.32178e-66
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14299
tcggcacgagggtCGATCGATGGCGTCGGAG*AAAGACGCGGCGCTCGCCGCCGTGCCCAACGACAACCCC*ACCATATTTGACAAGATCATCAAAAAGG
AGATACCTTCTACAGTGGTGTATGAGGATGAGAAGGTCCTCGCTTTCAGAGACATAAATCCTCAAGCTCCGACCCACATTGTAATCATTCCCAAAGTCAA
GGATGGATTAACCGGCCTTTCAAAGGCAGAAGAGAGGCATGTAGAGATACTTGGCTGTCTCCTCTACGCTGCAAAAGTTATCGCAAAGCAGGAAGGACTT
GAAGATGGCTACCGTATTGTCATCAATGATGGCCCTAGTGGATGTCAATCTGTTTACCACATCCATGTCCATCTCCTTGGAGGGAGGCAGATGAACTGGC
CCCCAGGCTAAAGAAGCTCTTGGTTGTCGGTCAATCTTCATGGCAGCTATGTCCTTTGCATCCCAATCGAATAATTCCTGTAATTGACATAACAGTTTGT
GCGAGGAACATTTGCTCTATCTATGGAATTGGCAAAACCATCCTGCTGTGAATGTATGGACAAGAAACTTGAAGCTGAATCGTCTCATTGATGCGTGTTG
TGTTCTTTCTATTCAGTCTGCTATTTTACTGGTTTAGTACTCCCTTTTGGACACTATACTCTTATATTATACtggaagg
page-top