Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5138  (registered. 2012)
Contig Information
Length 644 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_SHC Shoot grown with cold treatment 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226499620|ref|NP_001148686.1|| PP2Ac-2 - Phosphatase 2A isoform 2 belonging to family 2 [Zea mays]
Score 333
Evalue 8.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5138
GCCTCCTCCTCCTCCCTCCTCCCCCCCACTCGCGGTCGCCTCTCCCGATAGATCTGGTGCCAGGGTTCGCGGCGCCGGCGGACGTGCGGGGGGAGGGGTC
GACGCGTGCCTGGTGGCCGGAGGGGAGGATGGGGAATCCGCGTGGCGGCCTCGATGAGCAGATCGAGCAGCTCCTGCAGTGCAAGCCCCTCGTCGAGCCC
GAGTTGAAAGCACTGTGTGAGAAAGCTAAAGAGATTTTGATGGAGGAGAGCAATGTTCAGCCTGTGAGAAGCCCTGTCACGATATGTGGTGATATTCATG
GTCAGTTTCATGATCTTGCGGAACTATTCAGAATTGGTGGGAAGTGTCCTGATACAAACTACCTATTTATGGGAGATTATGTGGACCGTGGTTACTATTC
TGTTGAAACTGTATCGCTTCTGGTAGCTTTGAAAGTTCGTTATCCGCATCGTCTTACAATTCTTAGAGGAAACCACGAGAGCCGGCAGATCACTCAAGTT
TATGGATTTTATGATGAGTGCCTACGGAAGTATGGGAGTGCTAATGTATGGAAAACCTTCACGGATCTTTTTGACTATTTACCATTGACAGCATTGGTTG
AGTCNNAAATATTTTGCCTGCATGGTGGACTATCACCATCCATC
page-top