Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5137  (registered. 2012)
Contig Information
Length 955 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|109450915|emb|CAJ13560.1|| unnamed protein product [Triticum turgidum]
Score 511
Evalue 6.00E-143
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5137
TTTTTTTTTTGGCTTCAGAAATATAATGTATAACGAGGTATATGCTCATACAGAACTGATATTAAGTTTTCAGAATCTAATCCTCATAGGTCCATGTGTC
ATGATTCATACTCCTAACTGTACAAAGAAATATTGCTGACTTATTATTGTACTGCTAATACATGCTAAAATGTGAGGATTGATCTTACGGCATACCAATA
CATGATCGATGTAGTAGGATCCTCCTATCTCATCAAAAACAAGGCAGTGACAGCAGACAGCAACAGAGCCCCCATTTTCATGCCCATTCCCAGTGCTGCT
GGTGCGTTCGACGAAGGACCTGCGGGTGCCTTCCCATTGTTCGTCTCAGGTTTCTCTGTCGGGCAAGTGTAGCTGCAGAGGCTCGGCCGGACAACCCGGT
AGACGCCTTTGCTTGCCAAGACGTAGATGTCCTTGTTGTTATCCTCGCCGAAGGAATATATGTAACCGAGCGACGGGAGAGGGCTCCCAGCGGCGCTGTC
ACAGGGGATGGGAGAGTTCTTGGAGCAGCTGAAGGAGATGAGACTGGAGGTGTAGTTCCCACTGCCCTCCGGGGTCTCCGTGCCAGTCCACATGGCTGAT
GCGTAAAGGTCAGCATACAGGTACCTTCCATACAGGCAGGGGTCGGTGGATCCTCGGTAGACATAACCACCCATGATCGACGCAGATCCTATGTTTTTAT
TGACATCAGAATGGCTGTATCCCATAATAGGAGGAATGACATTTACGGACTTGAGTGATGTGTTTCCTCCAGGTGTCCACGGTGGATTGTACACCAATGG
ACCCTCATATATACGCCATCCATAGTTTCCGGCCTTGGAGATCAAATCAACCTCTTCGTATTGGTCCTGACCAGTATCTGCACAGTAGAAGTACGAAGGC
CTCTCAAGATCAAAGCTGCATCTCCAAGGGTTTCTAACACCCAATGCCCAAATTT
page-top