Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14228  (registered. 2002)
Contig Information
Length 1192 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_027373 [Oryza sativa (japonica cultivar-group)]
Score 1142
Evalue 7.14399e-123
Total Hit Count 209
Registered year 2002
Contig Sequence     [ Download ]
>Contig14228
gcAACACTCCACGCGACCTCACCTAGGGTTTGCTCTCCTTTCCTCCCCCGTCCTGCTCTTCCCCAATCCGCCTTCCCCCCTCGATCTCCTCCCCCAGCCG
CCGTAGGCGGAGGCGGGGGCGGGGGCGAGCAGCGACGACAAGCTCGTCCAACGCCTGCCCGCCTCGGCGAAAAGTCTGTCACCATGTCTGACATGGAGTC
CGTGGCTACCCTCATGGAGTCGACAAGCTTGAAGATACAGCAGCTTCAGCGAGCATTTGCTGAGCTTGAGAGCCAGAGCGCTGTTACCATGAACTTTAAG
TGGAAGCAACTCGAGGACCATTTCCGTGGCCTTGAGCAGTCGCTCAAGAAAAAGTTTGATGAGTTGAAAAAGCAGGAGAAGGAGTTCCAGGAGACCGTCG
CAAAATCGGAGAAGATGCTGGAGCAGCAGGAGGCTGTTGTGGTGGCTAAGGAGCTGACTTCTCTGGAAAGGCTGCAGGAGAAAAGAGATGCTGCATTAGC
TATGATCTTTGGCAAGTCCAAGTTGTCGCTAAACACTAATTATATCACCCCAATGAATAAGCCACAGAGTAATTATACTGTGGGTACTCTTGATGTGAAG
TGGCCGAAGCATTCTCCCGAAGGAAATGCACGCACGCAAG*ATGGCAATGCTGCTGTGAAGCCTCGTTCTGAACTTGCCATTCTCTGCGAGGAGATGAAT
GTTAAAGGGCTTCATAAGTTCATATCTGACAACAGAAAGAACTTGACGTCTATCCGTGAGGAAATCCCGAGTGCACTTAAGGGAGCATCGCAACCATATG
TCCTGGTGTTGGATTCCTTGGAGGACTTTTATTCTGGAGATAATCTGGTGTTGGATGGGAAAAAGGATGGAGACCTTCTGGGTGTAAGAAGGACGTGCCT
TATGTTGATGGAGTCTCTTGTACAGCTGCAAGCTGATGATATAACTGGCTTGTTGTCTGAGGGGCAAATGTTTGCAACAAATGTGAAAGATCGGGCGAAA
AAGATTGCGTTTGAGTGGAAGTCCAAGTTGGACAGTCTTGACATTGATGCTAGCAATGGAAACTGCCTGGAAGCACATGCATTTCTTCAACTGCTTGCTA
CCTTTGGTATTTTTTCTGAATTTAATGAAGATGAACTTTGCAAACTTCTTCCTTCTGTCAGTCGACGTCGTCAAACACCTGagctttgccga
page-top