Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5136  (registered. 2012)
Contig Information
Length 1199 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XA Root 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242082990|ref|XP_002441920.1|| hypothetical protein SORBIDRAFT_08g004880 [Sorghum bicolor]
Score 581
Evalue 5.00E-164
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5136
ATATCGCAAAGGGGCAACAGCCTGATAGTATTGTTTTATATTTGTACCTTGAAGTGTCATACAACATGCAAGTATCATAAATGTTCGGTCCGGGAACTGT
CCAATGCTGCTTTTATTTCTGGTAATAGAGCACACAACTCAAAATACTGCTTCGGTGGATCCGAATTTGTTCACCTCGAAAATAGTTGCAAGAAACATAG
CCTTGTCATCTTCACTCACCAAAATGCAGTTCATCAGCAGCAAATATCAGCTAGTCTAGTGATACACCCTTAGGAGGGTCAAACTTAGACCCAAGATTGC
TCAATTTAGCATGAGCTTCAGCGTAGTCTTCAAAAAATGTATCCTGATCCTCAGCATACTTTTCGGCATAAATCTTGAATGATGGATCCTCAAAGAGCAC
AGCATCAGTGGGCAGAACTAGAAGGTCCTCGTCTCGTCGTTCTTTGACATGCTTGAAATAGCTGTTATCAAACTTGAGCCACTGTGATGTCCAAGATTGA
CCCCCAGGTGCACCAGGTCCATTTTTAGTGTATTTTGTTTCAGGTTTACCCCAGCCGCTGCGCTCTGGTCTTGATCGTCCAAGTGTGTGTGCTCCTGACA
ATGCAACAATTTCCTTGTCATTCAGGCCCATTCTGTAGAATACTTCTCGCAAATGTTCAGCAGGTGAAGGCGGACCAGCAGCAGGGAGTCTCCCCTCTGG
TGGGCACTGTTCAGGGGCAGAAACATCAACCCTTCCATAGATCATGGGGATTTTGGGGCCACCGGCTTCCTCAACGGCTGTAGCACTGGCAAGCTGAAAC
AGATCCGCATAAGTAACACATGCATATTTTTCCTTGATGGCTTGAATAAGTTTCAAAGCATTCACAAGACCAGCATTAGCCGCATGCTTTAACTCAATTT
CAAACATCAAGCTACCATTAGCTCCACCACACTTGGGCCACTCACTAATGTTCTTATCATAAGTACCAGCGTCATGCCAACCCAAGCGAACCAGGATGGG
ATGGCAGGACTTCTCCTTCAGCAGCTGCTTGACGTCCTCCCGCGCGCCCCTCAGCTCAGCCACCGCGTCCCCGGCCGCCGCCGAGCTAGCCTGACGCCGC
CCGAGCTCCTGCGATACGAGGAGGAGGCCCCGCAGAGGGTGGAAGGGAGACCCACCAGAGATCCCGCGGCGGAGGAGGTGGTGGACGGCCATGTCGGCT
page-top