Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14215  (registered. 2002)
Contig Information
Length 541 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0549900 [Oryza sativa (japonica cultivar-group)] >gi|113611472|dbj|BAF21850.1| Os07g0549900 [Oryza sativa (japonica cultivar-group)]
Score 415
Evalue 3.12097e-39
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14215
ttttttttttgATTTAGAATTGAACTGATTTCATTGAACACAACATACTTTGGGTATTACACAGCCTACTGAACCCAAG*ACAGAGCACAACGACGCACG
CCAAAGCAGTAAATCCCATCTACCACACAACACATGACACAGAGCAAACGAGGAAGTTGCCCCACTACTGGCACCACTAGACGAATCTAGCCTCCGAAGC
CGTAGAGGGTGCGGCCCTGGCGCTTGAGGGCATAGACGACGTCCATGGCGGTGACGGTCTTGCGGCGGGCGTGCTCCGTGTAGGTGACGGCGTCGCGTAT
GACGTTCTCGAGGAAGATCTTGAGGACGCCGCGGGTCTCCTCGTAGATGAGGCCGGAGATGCGCTTCACGCCGCCCCTCCTGGCCAGCCTCCGGATCGCC
GGCTTGGTGATGCCCTGGATGTTGTCGCGGAGGACCTTCCGGTGGCGCTTGGCGCCGCCCTTTCCCAGCCCCTTGCCGCCCTTGCCGCGCCCAGACATCG
TCGCTGGATTTGTTTTtgtttgagagaagaaggactcgtgc
page-top