Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14211  (registered. 2002)
Contig Information
Length 961 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 1
Wh_r Root 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0588300 [Oryza sativa (japonica cultivar-group)] >gi|15430709|gb|AAK98534.1|AF402793_1 putative glutathione S-transferase OsGSTT1 [Oryza sativa (japonica cultivar-group)] >gi|77551709|gb|ABA94506.1| Glutathione S-transferase, N-terminal domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113645397|dbj|BAF28538.1| Os11g0588300 [Oryza sativa (japonica cultivar-group)] >gi|125535012|gb|EAY81560.1| hypothetical protein OsI_36725 [Oryza sativa Indica Group] >gi|125577739|gb|EAZ18961.1| hypothetical protein OsJ_033170 [Oryza sativa (japonica cultivar-group)] >gi|215737787|dbj|BAG96917.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765661|dbj|BAG87358.1| unnamed protein product [Oryza sativa Japonica Group]
Score 962
Evalue 3.8032e-102
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14211
gctctcaaccaaggtgaggagggtgtgaTTACTTTCCCTTAAAAAAAAGGTGAGGAGGGTGTGGATCAATCGAATCCAATCGAATCCTAAGCTGAGGATG
GCGGCGGTGCTCAAGGTGTATGCGGACCGGCTGTCGCAGCCGTCGCGCGCCATCATCATCTTGTGCAAGGTCAACCGGATCGACTTCCAGGAGCTCACCG
TGGATCTCGCCAAGGGACAACACCGCGCACCAGAATTCACCAAAATCAACCCCATGGCACAGGTCCCAACAATCGTCGATGGAAGATTCAAACTCTTTGA
AAGCCATGCCATTCTGAGGTATCTTGCCACCGTCTTCCCCGGGGTTCCAGATCACTGGTATCCGGCCGACTTATTTACCAGAGCAAAACTCGAGTCTGTC
TTGGATTGGCATCACTCTAATCTGCGCCGTGGTGCAGCAACCTATGTACTGCACACCGCGTTGGGTCCTGCTCTCGGCCTCACACCGAATCCTGAAACCG
CAAAAGAGGCCGAGAAGTTGCTGTCGCGATCACTGGGAA*CGATCGAAACCGTGTGGCTCAAAGGCGATGCAAAATTCTTGAATGGCAACCCCCAGCCAT
CAATCGCAGACCTCAGCCTCGTGTGCGAGATAATGCAGCTGGAGGTTGTTGGTGATGAGCGACGTGACAGAATTCTGGGACCTCACGACAAGGTGCGCGC
TTGGATGGAGAATGTGAAGAAGGCCACCAGCCCTCATTTTGATGAGGTCCATGAGCTCATCTTCAAACTCAAGGCACGCTTGAACCCAGCAGCATCCAAG
CTCTGAAGAGATGGATCCTACACACATTTACCCAATTCTTCTTTCTTCTTGTCTTGGGATTAAAACAAGTACTAGCATCCATGTACTGTACGATGAAAGA
AAGAAATACTAGTATTGTTTCATTACGACATTTCGACATGAAGTAAGCAATACTAGTATtg
page-top