Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5134  (registered. 2012)
Contig Information
Length 965 bp
Clones alternative view 71 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 8
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_SP 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig5134
ATTTGCTAGTAAACAAAAACACCCCAACACCAAACCAATCCAAACGAACAAAAACCAAGTTCATTTGCATCGGCCAGTTGGAGTTGCCCTTACGTGATCA
GCATTCGAGTTGCCCAAAGGGCACTCCTCGGACAACATACCTACAGTATGAAACGTAGGTACAGCGGCTACAGGCCTACGGCAACCCAGTACCACATGCT
CAGTCTCGAAGTTACGAAACCATAACAGAAGCATATTCAGCACGCATTCACGATGCACTGATAGAACGTTAACTTAACATCCACCATAGTTACAAATCCA
TGTTACATAATTCACTTATAGCCCCATGCTTCAGAATTCATTCATAATCCAGAAAATAGTTTATTCAGGATACTGTTCCAGATCATAGTTTTGATGCTTC
TGGTGTTTACTGCATTCCCCTGTCATCAGACCCAGGAGGAATTCTTTATCCCTCCAGCCTCAGGTTCTTCTCCTTGGCACCTTGAGCCTTCTGCTATCTT
TGGCTTCTTGCATTCCACCTCATCTCCAATAGGAGTGTGTGGTCGTTTCGTGATATCGGGTTTCTTTTCATCATCTAAGAGCTTTCTATCCGACTCGTCC
ACATCCACGTCGTCGTCCTCGTCGCCTTCGTCGTCCTCGTCGCCATCCTCGCCCTCGACGATGTAGAATACATCACGAGCACGTTCGAAAGCACTCATTT
CCTCTCGTAACTTGTCGATCTTTTGCTCGAACGTCTTACCATCAGAACTGTTCATGATCGCGCGGATCTTGTCCAGACCAAAGTGTTGGAACAGGTCGGC
CAGGCGAGGAGGAAGAGGCGACGACTGTGGATAGGGTGAATAAATCACACTACAGTAGCCTTTGTCGCCGGTTGTCTTGCCTTCGCAGCGTGATGCCATC
CCAGCCATGGTTGCCGGAGGGGAACGGCGGCGGCGTGGGTAGATGGCTAGGGTTTCTCCTCGTGC
page-top