Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5133  (registered. 2012)
Contig Information
Length 826 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 7
Wh_SHC Shoot grown with cold treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 6
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|22038178|gb|AAG40562.1|| glutathione-S-transferase 2 [Aegilops tauschii]
Score 436
Evalue 2.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5133
ATCTCAGCCTTCACGCACACACACACATCCATCGTTCTAGGCTAGCTAGTTGGAGATGGCCGGAGGAGATGACCTCAAGCTGCTCGGCGCATGGCCAAGC
CCGTTTGTTACCAGGGTGAAGCTGGCGCTCGCCTTCAAGGGCGTGAGCTACGAGGACGTGGAGGAGAACCTGTACAACAAGAGCGAGCTTCTCCTCAAGT
CCAACCCGGTGCACAAGAAGATACCCGTGCTCATCCACAACGGCGCCCCGGTCTGCGAGTCCATGATCATTGTGCAGTACATCGACGACGTGTTCACCGG
CACCGGCCCGTCGCTTCTGCCCGTGGACCCCTACGAACGCGCCGTTGCTCGCTTCTGGGTGGCCTACGTTGACGACAAGCTGGTAGCCCCATGGAGGCAG
TGGTTGAAGGGCAAGACAGAGAAGGAGAAATCCGAGGGAAAGAAGCAGGCGTTCGCGGCGGTGGAGGTCCTGGAAGGGGCCCTGAGGGAGTGCTCCAAGG
GAGGGGGTTTCTTCGGCGGGGACGGCGTCGGGCTCGTCGACGTTGCGCTGGGAGGCGTGCTGTCGTGGATGAAGGTAACCGAGGTGCTGTCCGGTGACAA
GATCTTCGACGCTGCCAAGACCCCGCTCCTGGCCGCGTGGGTGGAGCACTTCAGCGGGCTCGACGCGGCCAAGGCAGCCCTGCCGGACGTGGGCAGGCTG
CTTGAGTTCGCCAAGGCACGAGAGGTTGCCGCTGCAGCGTCTAACTGAGCGAGCACACATCCAAAATAATTAAAATTTGTTATTTTTAAATGTTGTTTGT
TCGGTTGCTTGATGTAGTAGTGTACC
page-top