Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig513  (registered. 2012)
Contig Information
Length 1618 bp
Clones alternative view 43 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242058545|ref|XP_002458418.1|| hypothetical protein SORBIDRAFT_03g033140 [Sorghum bicolor]
Score 590
Evalue 2.00E-166
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig513
CTCCCCCAACCCCTCGCCGCCGCCGCATCCAAAACCCCTCCCCCCATCCACCTCGTCCTCTAATGGCATCACGGCCCATCAGGCGAAGCTGCTAGCTCGT
GTCTCCCATCCGCTTCCCGAATAGCTTGTTGATCTACCGCAGCCCCCCACCTCCGCCGCCGCCGCCATGACGACCCTCAACCAGTTCGATCTCCTCGGAG
ACGTCGACAACGACGACCCCACGCAGCTGCTTGCTGCGGCGGCGGCCGCCGCGGCAAAGAAGGCCCAGGCGAATAAGACGGAGGCAGCGCCTGCTGGAAA
GGCGGGCCAGACTGCGGCGGCGGCCAAGTTGCCGACCAAATCCGCTCCCCCGGCACAGGCTGGGAGGGATGCGAGGAGCGGAGGCCCACCATCACGTGGA
GGATTTGGCCGTGGTGAACCTGGCCGCGGCAGAGGTGGTGGCCGATACGGCCAGAACCGTGACTTTGGCAGTGAGAACACGAATGGCTACCAGGGAGGTT
ATGGCGGGGTAGGTTCTGGAGATGGCGCTGTAGCTGGAGGCGGTGATGGGGAGAGAGGCCCTCGACCATACCGTGGAGGCGGTGGTAGACGTGGTGGTTA
CCGCAACGGTGAGTTTGGTGATGACTCTGAGAGACCACCTCGGAGAAACTATGAGCGCCACAGCGGGACTGGTCGTGGCCAAGGGATGAAACGCGATGGT
GCAGGCCGTGGAAACTGGGGATCTTCCACTGATGAAGGTCTTGCACAGGAAACTGATGAAGCTCTTAAAATTGAGGACAATGCTCCCATCGCTGAGAAGC
AGGGTGAGCAGGATGATGCTCCTCCAACAACAGTGGAGAAGAAAGACCACAAGGATGGTGCTGCAAAGGAGGAGGAAGAGAATGAAGAGGATAAGGAGAT
GACTCTAGAGGAGTTTGAGAAAATAAGGGAGGAACAGCGGAAAGCACTACTAGCATTGAAGACTGAAGAAAGAAAGGTTGAAGTTGACAAGGACCTGCAG
TCTCTGCAGCCACTGTCTACCAAGAAAGCCAATGATGAGGTTTTCATTAAATTGGGTTCTGACAAGGAGAAGAAGAAGGAAAGTACTGAGCGTGATGAAC
GTGCCAAGAAGTCTCTTAGCATCAACGAGTTCCTCAAGCCTGCCGAGGGAGAACGATACTACGGAGGCCGTGGTCGTGGAAGGGGCCGCGGCGAGGGCCG
TGGAGACCGCGGCGGTTTCAGGGGCGGGTTTGGAGGAGGATACCAGCACGGACAGGCGGCCGCGCCATCCATCGAAGATCAGTCACAGTTCCCGACCCTG
GGCGGGAAGTGAAGGTTGTGTGCTGTGCTGTCCCGAGCGCCATCCTCGTTGTCTTGACTGGTGTTTGCCTTTAAATTTTGCCCGACGTTGGATTATTGTG
TCACGGTTAATCGGAACAAATAATGTGGTTTTTCTTTCAGTGTGTTACTCGATTTTGTATACCGGAGTTGATCGTCGGGACTAGGCCTCTAGCTAGTTTT
GTAGGCTAGCTTTGCGTTTGGTTAAAGATCANNTCGTATTATGCCTTCTTGCTTCTTCTAGCTTTTCTTTATTCGAAATGATATCACACAAAGCAATGAT
CCGTCTTGCTTCACTCAA
page-top