Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5127  (registered. 2012)
Contig Information
Length 976 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242055393|ref|XP_002456842.1|| hypothetical protein SORBIDRAFT_03g043910 [Sorghum bicolor]
Score 234
Evalue 1.00E-59
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5127
TTTTTTTTTTATCAAATATTTTCAAGCATTNNNNNCACAGTACCAAGCACAGGTTTCCACTTTCCCACAAGGAAAGACTACTAACAGTGTCCACTACCAC
CAGGTATGCAGATTGGTAATCACGTCTCGAGCACTTGTTAAATTGTTGGGGAAAAAACTGAATGTTCATGATGACCCTGTGAAGAATAGCTCAGATACAA
TCACCACAATGCCGGTGCCAAAAAAGGGTCACAGCTGCCACGGCTCTAATGCTCCAAGAATGGCGGATAGGATTAATTATCTGCCGTCGGGAGGTAGACC
CGGTGGAAGTTGCTCATGGTCAGCTTTCTCCGGCAGGTAGGGCACTTCTTCTGAGCCTGGATGGAGGCCTTGATGCACTTCTGGCAGAAGATGTGGCCGC
AGATGGTCGATGATGCATTGACCAGCTCATTCATGCAGACTGGGCAGCTGAACTTTGTTTCCTTTGGGATCTCCTTCACAGGTTCAGGGACAGGCTGCAC
CACCTTGGGCGGTATGTTGTTGGTCTCAGGTGTGTCTACTATGTTTATTACAAGGTCGGTGTTGGGTTGTGCTCTCGAGGGATTGTGCCTCGGGTTCATT
CCCAGAGACAGCAGAGTGTTCACATGCTCATCAAGAGCTTCCCCTGCTGGTCCAGCAGTAGTTTCAGAATCATCATCTATTATCACAGTGATAGGTCCTG
TCCTGGACGACTGTTGCCTTGCCTGAGACAGAGATTGAGGGGGCGGCCCTGAGGTATAAATCGCAACATCATCATCAATCACTTCCACATTGATGGGGAA
ACTATTCATGCCAATGTTTGACTCTGCAGCAGCAGATGACACCACGACCTGTGTGGTCTCGTAAAGCAGGGCAGCCACCNNNNNNNNNGGCTGCCTGTGT
GAGACAGGCTCATTGATGGAGAGTGAACCCCCAGTTCTGGCTACTTCAACAGCTGGAAATAAGTTCAGGTCCAGAA
page-top