Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14104  (registered. 2002)
Contig Information
Length 603 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_e Seed DPA10 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha purothionin [Triticum aestivum]
Score 634
Evalue 1.63929e-64
Total Hit Count 141
Registered year 2002
Contig Sequence     [ Download ]
>Contig14104
atagcctgccagcCATGGGAAGCAAGGGCTTCAAGGGTGTGATAGTGTGTTTACTCATACTGGGGTTGGTTCTGGAACAGCTGCAGGTAGAAGGCAAGAG
CT*GCTGCAGGAGCACCCTGGGAAGAAACTGCTACAACCTTTGCCGCGCCCGTGGTGCTCAGAAGTTATGCGCAGGCGTCTGTAGGTGTAAAATCTCAAG
TGGCCTAAGCTGCCCTAAAGGCTTCCCTAAATTGGCCCTTGAGTCCAACTCAGATGAACCAGACACCATTGAGTACTGCAACTTGGGATGTAGGTCTTCC
GTGTGTGACTACATGGTCAACGCAGCTGCTGACGATGAAGAGATGAAACTCTATGTGGAAAATTGTGCTGATGCTTGTGTCAGTTTCTGTAACGGTGATG
CTGGCCTCCCATCCCTTGATGCGTACTGATGCGTGTCCATGGTCTGAG*ATTTCACAGGG*CAAGGTCGTGTCTCACCTTTGCGTTCAATAAAATTGGAT
CCCATCGAGAGTATCCAAACCAGTGTGTCACCCTGTTTTATGTGTGTGTATGTCCATTCCTTGTTCGAAATAAAAGCCATCATGATGGATGCcaaaaaaa
aaa
page-top