Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14102  (registered. 2002)
Contig Information
Length 971 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_e Seed DPA10 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 1092
Evalue 3.16987e-117
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14102
ttttttttttaacattcaacaagcatattggttcaaattcacttattcataccaaaccataccagcAACTGTTTCCCCGAAACCAACACACATCATCAGG
ACTCATGGTCCATCAAACCAGATACAGTAGACTTAACACGAACAAGACACAGGACTAATAGCAGCAGGTCCAACGTCAGGGCAATTACTGACCACCACGG
AGGCGGAGCACCAGG*TGTAGGGTGGACTCCTT*CTGGATGTTGTAA*TCAGCAA*GA*GTGCGGCCATCCT*CCAGCTGCTTGCCGGCAAAGATGAGGC
GCTGCTGGTCCGGAGGAATGCCCTCC*TTGTCCTGGATC*TTGGCCTTGACGTTGTCAATGGTGTCGGAGGATTCCACCTCAAGTGTGATGGTCTTGCCG
GTGAGGGTCTTGACGAA*GATCT*GCATGCCTCCCCTAAGGCGGAGGACAAGGTGCAGGGTGGACTCCTT*CTGGATGTTGTAGTCAGCAAGGGTGCGGC
CATCCTCCAGCTGCTTGCCGGCAAAGATGAGGCGCTGCTGGTCCGGAGGAATGCCCT*CCTTGT*CCTGGAT*CTTGG*CCTTGACGTTGTCGATGGTGT
CAGACGACTCCACCTCAAGGGTGATGGTCTTGCCAGTCAACGTCTTGACGAAGATCTGCATGCCTCCACGAAGGCGGAGGACAAGGTGAAGGGTGGACTC
CTT*CTGGATGTTGTAGTCAGCAAGGGTCCTGCCATCCTCAAG*CTGCTTGCCAGCGAAAATGAGACGCTGCTGGTCCGGAGGGATGCCCTCCTTGTC*C
TGGATCTTGGCCTTGA*CATTGTCGATTGTGTCAGACGACTCGACCTCAAGGGTGATGGTCTTGCCAGTCAATGTCTTCACAAAGATCTGCATCTTGAGG
CGGCGGGGGAGGAGGATTCGACGAGCCTAGGGTTGATCGGCGACGAGattggtTGGGGATTTTTCgttcgc
page-top